ID: 992005669

View in Genome Browser
Species Human (GRCh38)
Location 5:72475192-72475214
Sequence CAGCCTGAAGACCTTCCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992005664_992005669 28 Left 992005664 5:72475141-72475163 CCATCTTTGCTCTGACATGCAGG 0: 1
1: 0
2: 1
3: 18
4: 209
Right 992005669 5:72475192-72475214 CAGCCTGAAGACCTTCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992005669 Original CRISPR CAGCCTGAAGACCTTCCTGT AGG Intronic
No off target data available for this crispr