ID: 992006089

View in Genome Browser
Species Human (GRCh38)
Location 5:72478866-72478888
Sequence TGGGCTTTGGACTGATTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992006089_992006094 -8 Left 992006089 5:72478866-72478888 CCCTGAAATCAGTCCAAAGCCCA 0: 1
1: 0
2: 2
3: 18
4: 214
Right 992006094 5:72478881-72478903 AAAGCCCAGGAACTTGGAAAAGG 0: 1
1: 0
2: 1
3: 23
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992006089 Original CRISPR TGGGCTTTGGACTGATTTCA GGG (reversed) Intronic
901082346 1:6590654-6590676 TGGGCTGAGGACAGATGTCAGGG - Intergenic
902454496 1:16522847-16522869 CGGGCTTTCGATGGATTTCAGGG - Intergenic
902497961 1:16887506-16887528 CGGGCTTTTGATGGATTTCAGGG + Intronic
903921076 1:26801378-26801400 TGGGCTTGGGGCTGATTTCAAGG - Intergenic
904979175 1:34482331-34482353 TGGGCTCTGGACTGAATTGTTGG - Intergenic
907393979 1:54177032-54177054 TGAGCTGTGGCCTGATGTCATGG - Intronic
907450825 1:54544719-54544741 TGGGCTTCGGACTTAGATCAGGG + Intronic
907464251 1:54624477-54624499 TGGGCTCAGGACTGAGATCAGGG + Intronic
908756064 1:67470009-67470031 TGGGCTTAGGACTTATCTGAAGG - Intergenic
911801006 1:102137831-102137853 TGGGATTTGGAGTGAGATCAGGG + Intergenic
913560773 1:120016964-120016986 TGGGCTGTGGAGTTATTGCAAGG + Intronic
913637354 1:120776639-120776661 TGGGCTGTGGAGTTATTGCAAGG - Intergenic
914281355 1:146176379-146176401 TGGGCTGTGGAGTTATTGCAAGG + Intronic
914542400 1:148627314-148627336 TGGGCTGTGGAGTTATTGCAAGG + Intronic
914624233 1:149443931-149443953 TGGGCTGTGGAGTTATTGCAAGG - Intergenic
915164977 1:153943313-153943335 TGGCCTTTGGCCTTATTTCATGG + Intronic
917315496 1:173720532-173720554 TGTTCTTTGAACTGATTTCTAGG + Intronic
919944508 1:202309529-202309551 TGGGCTCTGCCCTGATTCCAGGG - Intronic
920065931 1:203269730-203269752 TGAGCTGCGGCCTGATTTCATGG + Intronic
921435018 1:215108571-215108593 TGGCCTTGGCAATGATTTCATGG - Intronic
922442879 1:225671032-225671054 TGGGATTTGGACTGGCTTCCTGG + Intergenic
923511864 1:234659910-234659932 GGGACTTTGGAGTGAATTCAGGG - Intergenic
924677197 1:246191199-246191221 AGGGCCCTGTACTGATTTCAAGG - Intronic
1062948893 10:1481385-1481407 TGGGTTTGGCACTGATTTCTTGG + Intronic
1063587136 10:7362865-7362887 TGTGCTTTGGACAGATTCCTGGG + Intronic
1068164358 10:53309016-53309038 TGAACTTTGGAATGATTTAAGGG + Intergenic
1068193504 10:53685239-53685261 TGGTCTTTGCAGTGATTTCTTGG + Intergenic
1068489661 10:57707072-57707094 TGGGATTTGGACACATTTAAAGG + Intergenic
1069764172 10:70840394-70840416 TGGGGTTTGTGCTGTTTTCAAGG + Intronic
1070687617 10:78500829-78500851 TAGGGCTTGGACTGACTTCAAGG - Intergenic
1073336465 10:102714128-102714150 TGGGTTGTGGACTGATTTCGGGG - Intronic
1075673929 10:124282810-124282832 TGGGCTTTGCTATGACTTCAGGG - Intergenic
1075844100 10:125531037-125531059 TGGGCTTTGGACTGACTTTTTGG + Intergenic
1077807629 11:5605240-5605262 TGGGCTCAGGACTGCTTTCCTGG - Intronic
1079295761 11:19232237-19232259 TGGTATTTGGACTGATTTCTGGG + Exonic
1079712078 11:23697775-23697797 TGGTCTTTGGAATGATTACCAGG + Intergenic
1080062284 11:27969894-27969916 TAGGTTTTGGATTGATTTCTGGG + Intergenic
1080996334 11:37606910-37606932 TGGCCTTGGGAATGAATTCATGG + Intergenic
1081737468 11:45414001-45414023 TGGGCTTTGGAGTGAGTCCAGGG + Intergenic
1082824332 11:57567156-57567178 TGGGCTATGGGCTTATTCCAAGG + Intronic
1085725079 11:78948003-78948025 TGGGTTTTGGAAAGATTTCTTGG - Intronic
1087680711 11:101216007-101216029 TGGACTTTGAGCTGATTTAAAGG + Intergenic
1088748886 11:112827210-112827232 TGGCCTTTAGACTTAATTCATGG + Intergenic
1091016493 11:132055702-132055724 TGGCCTTTGTACTGCTTTGATGG - Intronic
1091961573 12:4699543-4699565 TGGTCTTTGGATTTATTTCCTGG - Intronic
1092847428 12:12596686-12596708 TGGGCCTTCCACTAATTTCAAGG - Intergenic
1093168726 12:15835451-15835473 TGGGATTTGGACATATTGCAGGG + Intronic
1095511625 12:42956922-42956944 TGGGAGTTGGAATTATTTCAGGG + Intergenic
1095683975 12:45011219-45011241 TTGGCTTTTGACTAATATCAAGG + Intergenic
1098624690 12:72649480-72649502 TGGTCTTGGCAATGATTTCATGG + Intronic
1099045820 12:77718136-77718158 TGGTCTTGGTACTGATTTCATGG - Intergenic
1099115108 12:78614353-78614375 TAGACTTTGAACTGAATTCAAGG + Intergenic
1100329969 12:93572806-93572828 TGGGATTCGCACTGACTTCAAGG + Exonic
1101927883 12:108988297-108988319 TGGACTTGGCAATGATTTCATGG - Intronic
1102435991 12:112923992-112924014 TGGTCTTTCCAGTGATTTCAGGG + Intronic
1104106221 12:125662060-125662082 TGTGCTTTGGGGTGATTGCAAGG + Exonic
1104592098 12:130092751-130092773 TGGGCTTTGAGCTGAGTCCAAGG + Intergenic
1105812030 13:24004067-24004089 TGGGCTTTGGTCTGTCCTCAAGG + Intronic
1106432615 13:29695318-29695340 TGGGCTGTGGACTCCTTTTAGGG - Intergenic
1106506761 13:30377160-30377182 TGGGCTATAGAATGATGTCAAGG - Intergenic
1107358265 13:39591734-39591756 TAGGCCTTGGACTGTTTACATGG + Intronic
1108001311 13:45907851-45907873 TGAGCTTTAGACTCATTGCAAGG + Intergenic
1108098606 13:46931582-46931604 TGGTCTTAGCAATGATTTCATGG - Intergenic
1111753108 13:92358881-92358903 AGGTCTTTGAAATGATTTCAAGG + Intronic
1111927590 13:94479669-94479691 TGGCTTTTGAACTGAGTTCAAGG - Exonic
1112294122 13:98171395-98171417 TGGGCTTTGGACTATTTTGTTGG + Intronic
1114581374 14:23763125-23763147 TGGCCTTTAGACTGCTTTCCTGG + Intergenic
1117463378 14:55968700-55968722 TGGGCTAAGGACAGATTTTAGGG + Intergenic
1118374186 14:65162688-65162710 AGGGCCTTGGAATGATTTCTGGG + Intergenic
1124406431 15:29396667-29396689 TGGGCTTGGCAGTGATTTCTTGG - Intronic
1125707832 15:41756116-41756138 TTGGCTTTTCACTGTTTTCACGG - Intronic
1126236478 15:46390761-46390783 TGGGCACTGGACTGATTGCCAGG - Intergenic
1127350036 15:58142084-58142106 TGGGCTCTGGGCTGATTCCCGGG - Intronic
1127729707 15:61788463-61788485 TGGTGTTTGGAGAGATTTCAAGG - Intergenic
1129348825 15:74941972-74941994 AGGGCTGTGGACTGCTCTCAAGG - Intergenic
1130540500 15:84817836-84817858 TCCACTTTGGAGTGATTTCATGG + Intronic
1132561885 16:598972-598994 TGGGCTTTCGCCTGACTTCCTGG + Intronic
1132601786 16:776037-776059 TGGCCTTTGGGGTCATTTCAAGG + Intronic
1134235860 16:12465540-12465562 TGGGCTTTGTTCTGTTCTCATGG + Intronic
1136513799 16:30755950-30755972 TGGGTTTTGGATTGATTTCAAGG - Intronic
1137583206 16:49647086-49647108 TGGGCCTTGGACTGGCTCCAGGG - Intronic
1138018262 16:53451756-53451778 TGTGCTTTGGACTTAGTTTATGG + Exonic
1138142013 16:54576943-54576965 AGCGCTTTGAACTGAATTCATGG + Intergenic
1143244006 17:5468110-5468132 TGGGGCAGGGACTGATTTCATGG - Intronic
1143833059 17:9667970-9667992 TGTGCTTTAGACATATTTCAGGG - Intronic
1145832708 17:27929967-27929989 TAGGATTTGGACAGATTTCTTGG - Intergenic
1146820735 17:35982137-35982159 CGGACTTTGGACTGATTTTTAGG + Intergenic
1149208084 17:54272145-54272167 TGTGTTTTTCACTGATTTCAAGG + Intergenic
1150824394 17:68461837-68461859 TGGGCTGTGGGGTGATTTCTGGG + Intergenic
1157429260 18:47611083-47611105 AAGGTTTTGGAGTGATTTCAAGG - Intergenic
1159483754 18:69026617-69026639 TGGGCTTTTCTCTGACTTCAGGG - Intronic
1163927899 19:20362815-20362837 TGGGATATGGACTGAGTCCAGGG - Intergenic
1166459869 19:42977574-42977596 TGGGACTTGGACTGACTTCCTGG + Intronic
1166477193 19:43137628-43137650 TGGGACTTGGACTGACTTCCTGG + Intronic
925644909 2:6025915-6025937 AGGGCTTTGGACTGAAATCTAGG + Intergenic
927999119 2:27507628-27507650 TGTGCTTTAGAGTGTTTTCATGG + Intronic
931209267 2:60177256-60177278 TGGGCTTTCAACTGATTGGATGG - Intergenic
932376286 2:71238821-71238843 TGTGCTTTGGACAGATTTTTTGG + Intergenic
937236840 2:120436338-120436360 GGGGCTTAGGACTGATTTATAGG + Intergenic
937471754 2:122179886-122179908 TGGGCTTGTGATAGATTTCAGGG - Intergenic
939158326 2:138553362-138553384 TCACCTTTGGACTGAATTCAAGG + Intronic
939423315 2:142001946-142001968 AGTGTTTTGTACTGATTTCATGG - Intronic
942329361 2:174805887-174805909 TGGGCTTTGAGTTGATCTCAAGG + Intronic
943850304 2:192712280-192712302 TGGGTTTTGGACTCCTTACAAGG + Intergenic
945385308 2:209191511-209191533 TGGGCTTGGCAATGATTTCTTGG - Intergenic
945810229 2:214540794-214540816 GGGACTTGGGACAGATTTCATGG + Intronic
947258694 2:228196128-228196150 TGGTCTTGGCAATGATTTCATGG + Intergenic
1168808482 20:687186-687208 AGGGCTTTGGTCTGATTTGAGGG + Intergenic
1169257689 20:4111364-4111386 TGGGCTCTGGCCTGAGTTCCTGG - Intergenic
1170388061 20:15841922-15841944 TGGGACTTGGACTGAATTCAAGG + Intronic
1170813671 20:19695205-19695227 TGGCCTTTGGAGTGAAGTCAGGG + Intronic
1170864607 20:20142428-20142450 TGGGCTTTGAAATGATCTCCAGG - Intronic
1174101837 20:48132706-48132728 TGGTCTTGGCAGTGATTTCATGG - Intergenic
1176299828 21:5094404-5094426 CGGGCGTGGGTCTGATTTCAGGG - Intergenic
1178619547 21:34161708-34161730 TTGGCTTAGGACTGGGTTCAGGG - Intergenic
1179378147 21:40870609-40870631 TAAGCTTTGGGCTGTTTTCACGG - Intergenic
1179857194 21:44167507-44167529 CGGGCGTGGGTCTGATTTCAGGG + Intergenic
1181122649 22:20682226-20682248 TGGGCTTTGGAATCAGTTCAGGG - Intergenic
1181179777 22:21058859-21058881 TGGGCTTTGGAATCAGTTCAGGG + Intronic
1181422567 22:22811885-22811907 TGGGCTTTGCACAGGGTTCAGGG - Intronic
1182316941 22:29453979-29454001 TGGGCCTTGGACAGGTTTCTTGG + Intergenic
1182962645 22:34490071-34490093 GGGGATTTGGACTGGTTTCCTGG - Intergenic
1183104279 22:35605145-35605167 TGGTTTTTGGGCTGATTCCAAGG - Intergenic
1183176857 22:36230725-36230747 TGGGCTCTGGGCTTATGTCATGG - Intronic
1184913654 22:47552269-47552291 TGGCCTTTGGTCTGAGTTGAAGG - Intergenic
949338877 3:3007019-3007041 TGGGATTTGGTATGTTTTCAGGG - Intronic
950935690 3:16836635-16836657 TGGCCTTTTCCCTGATTTCAGGG - Intronic
956615185 3:71164045-71164067 TGGGGATTGGACTGATGGCATGG - Intronic
959021459 3:101191753-101191775 TGGTCTTTGCACTGATTCCTGGG - Intergenic
959607352 3:108256682-108256704 TGGGTTTTGTAATGATTTCCTGG + Intergenic
959647642 3:108721794-108721816 TGTCCTTTGGACAGATCTCATGG - Intergenic
959871761 3:111337133-111337155 TGGGCATTTGCCTGATTTCATGG + Intronic
960356147 3:116655895-116655917 TGGGCTGTTCACTTATTTCAGGG - Intronic
961826475 3:129601794-129601816 TGGGCTCTGGACAGATTTGGGGG - Intronic
962337350 3:134547103-134547125 TGGGATTTGGCCTTTTTTCAAGG - Intronic
964581782 3:158247464-158247486 AGGGTTTTGCACTGATTTCAGGG + Intronic
964800288 3:160549342-160549364 TGGTCTTGGCACTGATTTCTTGG - Intronic
966591443 3:181687896-181687918 TGGCCTGTGGCCTGATTTCCTGG + Intergenic
967769330 3:193316960-193316982 TGGTCTTGGCAATGATTTCATGG + Intronic
969836697 4:9848176-9848198 CGAGCTTTGGAAAGATTTCAAGG + Intronic
970267463 4:14304658-14304680 TGGTCTTGGCAATGATTTCATGG + Intergenic
971659548 4:29394430-29394452 TGGAGTTTGGGCTGATATCATGG + Intergenic
972400984 4:38703495-38703517 TGGGCTTTGGTTTGCTTACACGG + Intergenic
977028745 4:91855512-91855534 TAGTCTTTGGAGTGAGTTCAAGG - Intergenic
977150016 4:93499562-93499584 GGGGGTTTTGAGTGATTTCAGGG - Intronic
980735101 4:136875130-136875152 TGGTCTTTGAAATGATTTCATGG - Intergenic
983951006 4:173641402-173641424 TGGTCTTGGCAGTGATTTCATGG + Intergenic
984072039 4:175127297-175127319 TGAGATTTGGATTGATTTTACGG - Intergenic
985425252 4:189823841-189823863 TGGGCTTTGGCATGACTTCCTGG - Intergenic
986862236 5:11940332-11940354 TGGTCTTTGCAATGATTTCTTGG + Intergenic
987589021 5:19898736-19898758 TGGGCTTGGCAGTGATTTCTTGG + Intronic
988449991 5:31332270-31332292 GAGGCTTTGGACTGATCTTACGG - Intergenic
989731055 5:44649349-44649371 TGAGCTTTTGAGAGATTTCATGG - Intergenic
989756697 5:44963718-44963740 TGGGCTTTGAAATGATCACATGG + Intergenic
991716850 5:69459113-69459135 TGGGTTTGGCAATGATTTCATGG - Intergenic
992006089 5:72478866-72478888 TGGGCTTTGGACTGATTTCAGGG - Intronic
993592194 5:89808026-89808048 TGGGTTTTTGAATGATTACATGG - Intergenic
996027879 5:118669222-118669244 TGGGCTGGGCAATGATTTCATGG - Intergenic
997016519 5:129941813-129941835 TGGACTTTTGACTGGTTTCTGGG - Intronic
998010567 5:138692167-138692189 TGGGCTATGCAAAGATTTCATGG - Intronic
998101997 5:139442208-139442230 TGAGCTTTTGACTCATCTCATGG - Intronic
1000107013 5:158069448-158069470 TGGGGTTTGGATTGTTTTTAAGG - Intergenic
1000174887 5:158742236-158742258 TGGGTTCTGGAGTGTTTTCATGG - Intronic
1000876719 5:166648476-166648498 TGGCCACTGGACTGCTTTCAAGG - Intergenic
1004336260 6:14767291-14767313 AGGGCTTATGACTGATTTAAAGG - Intergenic
1005558907 6:27017790-27017812 TGGCCTTTGTAATGATTTCTTGG + Intergenic
1007688652 6:43683146-43683168 TGGGCTTTGATCTGTTTTCCAGG - Intronic
1007950125 6:45864611-45864633 TTGGCTTTTAACTGCTTTCATGG + Intergenic
1009600742 6:65794618-65794640 TTGGACTGGGACTGATTTCATGG + Intergenic
1010399067 6:75427768-75427790 TGGGCTTGGGGCACATTTCAAGG - Intronic
1010871886 6:81052847-81052869 TGGGCTTTTGACTAATTTTCAGG - Intergenic
1013944340 6:115704204-115704226 TGGGCTCTGGACTGGTGTTAGGG + Intergenic
1013990635 6:116251159-116251181 TGGGCCTTGGACTGCTTCTAGGG - Exonic
1015409816 6:132880793-132880815 TGGGCTTAGGCCTGAATTGAAGG + Intergenic
1015745743 6:136507852-136507874 TGGGCTCTGGACTGGCTCCAGGG + Intronic
1015945823 6:138499816-138499838 TGGGATTTGAACTGATTTAGGGG + Intronic
1016885082 6:148951471-148951493 TGGCCTTTAGTCTGATTCCATGG - Intronic
1016971008 6:149764099-149764121 TGGGATTTGAATTAATTTCAGGG + Intronic
1018528715 6:164741011-164741033 TGGGCTTTGGCCTGAATACAGGG + Intergenic
1020707560 7:11564635-11564657 TGGGCTGTCTCCTGATTTCAAGG + Intronic
1022873760 7:34506694-34506716 TGGGCACTGGAATGTTTTCAAGG + Intergenic
1023745833 7:43321552-43321574 TTGGGTATGGAGTGATTTCATGG + Intronic
1023857475 7:44193521-44193543 TGGGCTTTGCTCTGATTGGATGG + Intronic
1023949213 7:44828611-44828633 TGGGCTTTGTAATTCTTTCAAGG - Intronic
1024437107 7:49370558-49370580 TGGGCTTGGCAATGATTTCATGG - Intergenic
1024809711 7:53193680-53193702 TGGGCTATGGAATCATTCCAGGG - Intergenic
1026809320 7:73449064-73449086 TGGGCATTGGATTGATATCATGG + Intronic
1030304083 7:108002325-108002347 GGGGCTCTGGAGTGGTTTCAAGG + Intronic
1030436345 7:109526121-109526143 TGTGTTTAGGACTGATTTCCTGG + Intergenic
1030546618 7:110904310-110904332 TGGTCTTGGCAGTGATTTCATGG - Intronic
1032531507 7:132624547-132624569 TGGGCTTTGAATTGGTTTCTAGG - Intronic
1032631155 7:133653602-133653624 TGAGCTTTGGACAGTTTACAAGG - Intronic
1032638965 7:133743638-133743660 GGGGGTTTTGACTAATTTCATGG - Intronic
1032891975 7:136206670-136206692 TTGGCATTAGAGTGATTTCAAGG + Intergenic
1033518878 7:142139723-142139745 ATGGCTTTGGCCTGCTTTCAGGG + Intronic
1034046367 7:147932641-147932663 TGGTCTTTGCAATGATTTCTTGG + Intronic
1035838103 8:2778494-2778516 TGGCTTTTAGACTTATTTCAAGG - Intergenic
1036167837 8:6453926-6453948 TGGGCCCTGGACAGATTTTAAGG - Intronic
1039134658 8:34307921-34307943 TGGTCTTTGCAATGATTTCTTGG + Intergenic
1039502589 8:38029818-38029840 TGGACGTTGGACTCAATTCAGGG + Intergenic
1039519813 8:38160715-38160737 GGGGCTTGAGACTGCTTTCAGGG - Intergenic
1039625291 8:39044148-39044170 TGGTCTTGGCAATGATTTCATGG - Intronic
1039656503 8:39414297-39414319 TGGTCTTGGCAATGATTTCATGG + Intergenic
1042044340 8:64631500-64631522 TGGTCTTGGTAATGATTTCATGG + Intronic
1042363967 8:67915147-67915169 TGGGCTTTGGTTTGCTTACATGG - Intergenic
1045791891 8:105993151-105993173 TGAGCTGTGGTCTGCTTTCAAGG + Intergenic
1047163522 8:122409463-122409485 TGGGATGTGGTCTGTTTTCAGGG + Intergenic
1048871392 8:138802417-138802439 TGGGTTTTGGAGTGATGTCTTGG + Intronic
1048980382 8:139700586-139700608 TGGGCTTTCCACTGATTTTCTGG - Intronic
1049187527 8:141265452-141265474 TGGGCGTTGGACTGGTTTTATGG - Intronic
1051009475 9:12393980-12394002 TGGGCTTAGCCCTAATTTCAGGG - Intergenic
1052503918 9:29328401-29328423 TGGGACTTGGACTGGTTTCCTGG + Intergenic
1056317608 9:85406329-85406351 TGGGCTATGGTCTGATTCAAGGG - Intergenic
1056810401 9:89759482-89759504 TGATCTTAGGACAGATTTCAAGG - Intergenic
1057516571 9:95727017-95727039 TGGGCTTTGGACAAAATACAAGG + Intergenic
1058825288 9:108770359-108770381 GGGGCTTTGGTCTCATCTCAAGG - Intergenic
1059810992 9:117855413-117855435 TGGGCTTTGGACCTATAACATGG + Intergenic
1061417222 9:130453653-130453675 TGGGCTTTGGCAAGATTCCAGGG + Intronic
1061661723 9:132134737-132134759 TGGGCTTTCGGCTGATTGGATGG - Intergenic
1185728299 X:2440765-2440787 TGGGCCTTGGACTGGCTTCCTGG + Intronic
1188079702 X:25822006-25822028 TGGTCTTTGCAATGATTTCTTGG + Intergenic
1188949665 X:36354817-36354839 TGGTCTTGGCAATGATTTCATGG + Intronic
1192664315 X:73071323-73071345 TGGTCTTGGCAATGATTTCATGG + Intergenic
1192664523 X:73074521-73074543 TGGTCTTGGCAATGATTTCATGG - Intergenic
1193261033 X:79406447-79406469 TGGACTATGGATTGTTTTCATGG - Intergenic
1194463973 X:94208596-94208618 TGGTCTTGGCAGTGATTTCATGG - Intergenic
1194989457 X:100530576-100530598 TGGTCTTGGCAATGATTTCATGG - Intergenic
1195517694 X:105796316-105796338 TAGGCTTTGAACTTATTTTAAGG + Intergenic
1196578565 X:117351620-117351642 TGGGCTTTTGTTTGATTTCTTGG - Intergenic
1197359603 X:125483827-125483849 TGGTCTTTGCAATGATTTCTTGG + Intergenic
1197529627 X:127606742-127606764 TGGGAGTTGGACTGATTCCAGGG + Intergenic
1198554716 X:137780799-137780821 TTTGCTTTTGACTGTTTTCATGG - Intergenic
1201413686 Y:13726619-13726641 TTGGCTTAGGATTGATTTCGTGG - Intergenic
1202180938 Y:22139334-22139356 TAGGCTTGGAACTGAATTCAAGG + Intergenic
1202210422 Y:22447066-22447088 TAGGCTTGGAACTGAATTCAAGG - Intergenic