ID: 992006266

View in Genome Browser
Species Human (GRCh38)
Location 5:72480914-72480936
Sequence ATACAGGGGCTCTTAAAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992006266_992006271 6 Left 992006266 5:72480914-72480936 CCACGCTTTAAGAGCCCCTGTAT 0: 1
1: 0
2: 0
3: 9
4: 88
Right 992006271 5:72480943-72480965 TTGCCTAAGAAGTGAGCCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 142
992006266_992006270 5 Left 992006266 5:72480914-72480936 CCACGCTTTAAGAGCCCCTGTAT 0: 1
1: 0
2: 0
3: 9
4: 88
Right 992006270 5:72480942-72480964 ATTGCCTAAGAAGTGAGCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992006266 Original CRISPR ATACAGGGGCTCTTAAAGCG TGG (reversed) Intronic
900632229 1:3643371-3643393 AGAGAAGGGCTCTGAAAGCGCGG + Intronic
901190500 1:7407287-7407309 ATACAGAGGCTATTAAAGCCAGG + Intronic
908442425 1:64168889-64168911 TTCCAGGGGCTCTCAAAGTGAGG + Intronic
909995138 1:82269765-82269787 ATACAGGTGCACTTACAGTGGGG + Intergenic
915631316 1:157155564-157155586 ATACAGGGGCTGGAAAGGCGGGG + Intergenic
919193375 1:194252273-194252295 ATACAGGGGCTGATGAAGTGTGG + Intergenic
1068379137 10:56226575-56226597 ATACAGGAGCTCTTTAAGAGTGG - Intergenic
1070505415 10:77108494-77108516 ATACGGGGGCTCCTATAGTGCGG - Exonic
1071694437 10:87857147-87857169 ATACAGGGTCTCTTAAATCCTGG - Intergenic
1073537641 10:104292132-104292154 AGACAGGGGTTCTGAAAGTGAGG + Intronic
1075144078 10:119868599-119868621 ATACAGGGGCCCTGAATTCGCGG + Intronic
1077746083 11:4907527-4907549 ATACATGGGCTCATGAAGCGAGG - Exonic
1077873886 11:6286688-6286710 ATACAGGGGCTCTTAAATGCAGG + Intergenic
1083652193 11:64210250-64210272 AGACAGAGGCTGTTAAACCGTGG + Intronic
1087844712 11:102960204-102960226 AGACAGGGGCTTTTAAAAGGAGG + Intergenic
1093014515 12:14142913-14142935 AAACAGGGTCTCTTGAAGCTGGG - Intergenic
1094649663 12:32363011-32363033 AGACAGGGTCTCTTAAAGCCTGG - Intronic
1095350382 12:41203682-41203704 ATACAGGAGCTCTTACTGTGTGG - Intronic
1096234039 12:49913725-49913747 ATTCAGGGGCTGTTTAAGGGGGG + Intergenic
1099072350 12:78061039-78061061 AAACAGTGCCTCTTAAAGTGTGG + Intronic
1100236807 12:92669741-92669763 ATGGAGGAGCTCCTAAAGCGTGG - Intergenic
1101014031 12:100481021-100481043 CTACAAGGTCTCTTAAAGCCTGG + Intronic
1101491045 12:105209927-105209949 ACACAGGGGATCTCAAAGCAAGG + Intronic
1103645290 12:122387211-122387233 ATACAGTGGTTCTCAAAGTGTGG + Intronic
1107149274 13:37092713-37092735 ATACAGGGGCTTATAACACGTGG + Intergenic
1108695856 13:52901738-52901760 ATACAGTGGTTCTCAAAGTGTGG + Intergenic
1109321828 13:60819277-60819299 ATACAGGGACTTTGAAAGAGTGG - Intergenic
1109362326 13:61311212-61311234 ATACAGGGGAGCTAAAAACGTGG - Intergenic
1112375528 13:98836540-98836562 CTACAGGGGCTCTCAGAGTGTGG - Intronic
1113449597 13:110397929-110397951 ATACAGCTGCTCTTAAAGCAAGG - Intronic
1117866819 14:60158674-60158696 TTTCAGGGGCTCTTAAAGGGAGG - Intronic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1118842960 14:69526570-69526592 GTTCAGGGGCTCATAAAGCCTGG + Intronic
1119685540 14:76628057-76628079 ATGCAGTGGCTCTTAAAGGAGGG - Intergenic
1124351461 15:28958677-28958699 ACACAGAGGCTGTTAAAGCCAGG - Intronic
1125524526 15:40366788-40366810 CTACAGGGGCCCTTACAGCAGGG + Intronic
1127643221 15:60934704-60934726 ATACAGTGGTTCTCAAAGTGTGG - Intronic
1128737815 15:70063209-70063231 ACACAGGGCCTCATAAAGCTGGG + Intronic
1145786113 17:27594913-27594935 ATACAGTGGCTCTGAAAGGTTGG + Intronic
1147546409 17:41405444-41405466 GGACAGTGGTTCTTAAAGCGTGG - Intergenic
1148618650 17:49018112-49018134 CTACTGAGGCTCTTACAGCGTGG - Intronic
1156870938 18:41944415-41944437 AAGCAGGGGCTTTTAAAGGGGGG + Intergenic
1157256560 18:46144828-46144850 ATGCAGGGGGTTTTAAAGAGAGG + Intergenic
1164562571 19:29302851-29302873 ACACAGGGGCTCTCAGCGCGTGG + Intergenic
1165384144 19:35500633-35500655 AAACTGGGGCTCTGAAAGCCCGG - Intronic
1168100120 19:54137196-54137218 AGACAGGTGCCTTTAAAGCGGGG - Intergenic
930864857 2:56112335-56112357 AAACAGTGGTTCTTAAAGCCTGG + Intergenic
931580770 2:63770618-63770640 ATACAGTGGTTCTCAAAGTGTGG + Intronic
932275642 2:70450348-70450370 ATACAGCTTCTCTTAAAGCTAGG + Exonic
933093810 2:78153082-78153104 ATACATGGGCTTTTATTGCGTGG + Intergenic
933671249 2:85009487-85009509 GTACAGGGGCTCTTTCAGCCTGG + Intronic
934784179 2:96992722-96992744 ATACAGTTGCTCTTTAAGAGAGG - Intronic
935515990 2:104039556-104039578 CTGCAGGGCCTCTTAAAGCCTGG + Intergenic
941360968 2:164551021-164551043 ATTCAGGAGCTCTAAAAGCCAGG + Intronic
943120146 2:183725259-183725281 ATACAGGGGTTCTAAAGGAGTGG - Intergenic
1174043563 20:47717196-47717218 AACCAGTGGCTCTCAAAGCGTGG - Intronic
1175547743 20:59789741-59789763 ACACAGGGGCTTATAAAGCCAGG + Intronic
1181895373 22:26102667-26102689 ATTCAGTGGCTCTCAAAGTGTGG - Intergenic
1184736060 22:46398370-46398392 AAACAGGAGCTGTTAAAGTGGGG + Intronic
1185052006 22:48559009-48559031 ATACAGGGGCCCTTATACTGGGG + Intronic
952058633 3:29480202-29480224 ATACAGTTGTTCTTAAAGTGTGG + Intronic
954127133 3:48538225-48538247 ATGCAAGGGGTCTTAAAGCAGGG - Intronic
954914457 3:54136898-54136920 AAACAGTGTCTCTCAAAGCGTGG - Intronic
960113886 3:113873384-113873406 ATACAGTGGTTCTCAAAGTGTGG + Intronic
962425031 3:135262161-135262183 ATACAGTGGTTCTCAAAGCATGG - Intergenic
963367895 3:144362454-144362476 ACACAGTGGTTCTTAAAGTGTGG + Intergenic
964694119 3:159487738-159487760 CTACAGGGGATCTTAAAGGGAGG + Intronic
967661229 3:192112849-192112871 ACATAGGGGTTCTTAAAGGGTGG + Intergenic
978599486 4:110413004-110413026 GTACAGGGGCTCTGAAATGGAGG - Intronic
979201432 4:117984080-117984102 ACACAGTGGCTGTTAAAGCTGGG - Intergenic
981317319 4:143351869-143351891 ATAGAGGGGTTCATAAAGCTTGG + Intronic
989770080 5:45134336-45134358 ATACAGTGGCTCTTAATTCTTGG - Intergenic
992006266 5:72480914-72480936 ATACAGGGGCTCTTAAAGCGTGG - Intronic
994704476 5:103184345-103184367 ATACAGGAGCTGTTTAAGAGTGG + Intronic
997080205 5:130729520-130729542 ATACAGCAGTTCTTAAAGCATGG - Intergenic
1006911133 6:37564382-37564404 ATAGAGGGGCTCTTGAAGGAGGG - Intergenic
1007357857 6:41333922-41333944 GGACAGGAGCTCTCAAAGCGGGG - Intergenic
1007525343 6:42487618-42487640 ATACAGGGGTTCTTAATTTGGGG - Intergenic
1012046649 6:94283969-94283991 ATATCTGGGCTCTTAAAGGGGGG + Intergenic
1017327154 6:153152542-153152564 GTACAGGGGCTCTTGAGGCTCGG + Intergenic
1024637145 7:51300462-51300484 AAACAGAGGTTATTAAAGCGGGG + Intronic
1025620545 7:63166279-63166301 GTACAGGGGCTCTGAAATGGAGG - Intergenic
1028162996 7:87507373-87507395 TTACCTGGGCTCTTAAAACGTGG + Intronic
1029981180 7:104880470-104880492 ATACAGGGGCTGATACAGCTGGG + Intronic
1034450595 7:151135214-151135236 AGCCAGGGGCTCTGGAAGCGAGG - Intronic
1035645584 8:1216290-1216312 ATACAGGGGCTCTGATATCCAGG + Intergenic
1039743340 8:40401905-40401927 ACACAGGGGTTTTTAAAGCAGGG - Intergenic
1041596172 8:59655898-59655920 ATGCAGTGGTTCTTAGAGCGTGG - Intergenic
1047876217 8:129140703-129140725 GTACAATGGCTCTTAAAGAGTGG + Intergenic
1048861180 8:138725344-138725366 CTACAGGGGCTCTTAGATGGTGG - Intronic
1049982500 9:917197-917219 ATACAGGGGCACTTTAAATGTGG + Intronic
1059314943 9:113416261-113416283 ATAAAGGGGCTTTTCAAGCAAGG - Intronic
1187421049 X:19133964-19133986 ATACAATGGCTCTCAAAGTGTGG - Intergenic
1187510536 X:19913666-19913688 ATACAGTGGTTCTCAAAGTGTGG - Exonic
1189871107 X:45383768-45383790 ATACAGTGGTTCTCAAAGGGTGG + Intergenic
1195571200 X:106400367-106400389 ATAAAGGAGCTCATAAAGAGGGG - Intergenic
1197695186 X:129541766-129541788 ATACAGAGGATCTAAAAGTGGGG - Intronic
1198273805 X:135081811-135081833 ATACTGGTTCTCTTAAAGGGTGG + Intergenic