ID: 992007251

View in Genome Browser
Species Human (GRCh38)
Location 5:72490110-72490132
Sequence TTGAAGCCTGGAACTTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 180}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992007251_992007256 2 Left 992007251 5:72490110-72490132 CCTCCACAAGTTCCAGGCTTCAA 0: 1
1: 0
2: 1
3: 9
4: 180
Right 992007256 5:72490135-72490157 GTAGCTTCAAGGGTCAGAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 172
992007251_992007255 -8 Left 992007251 5:72490110-72490132 CCTCCACAAGTTCCAGGCTTCAA 0: 1
1: 0
2: 1
3: 9
4: 180
Right 992007255 5:72490125-72490147 GGCTTCAAGAGTAGCTTCAAGGG 0: 1
1: 0
2: 0
3: 20
4: 116
992007251_992007259 15 Left 992007251 5:72490110-72490132 CCTCCACAAGTTCCAGGCTTCAA 0: 1
1: 0
2: 1
3: 9
4: 180
Right 992007259 5:72490148-72490170 TCAGAGAAGGGAAGTCAACAGGG No data
992007251_992007254 -9 Left 992007251 5:72490110-72490132 CCTCCACAAGTTCCAGGCTTCAA 0: 1
1: 0
2: 1
3: 9
4: 180
Right 992007254 5:72490124-72490146 AGGCTTCAAGAGTAGCTTCAAGG 0: 1
1: 0
2: 1
3: 14
4: 137
992007251_992007257 3 Left 992007251 5:72490110-72490132 CCTCCACAAGTTCCAGGCTTCAA 0: 1
1: 0
2: 1
3: 9
4: 180
Right 992007257 5:72490136-72490158 TAGCTTCAAGGGTCAGAGAAGGG 0: 1
1: 0
2: 3
3: 19
4: 194
992007251_992007258 14 Left 992007251 5:72490110-72490132 CCTCCACAAGTTCCAGGCTTCAA 0: 1
1: 0
2: 1
3: 9
4: 180
Right 992007258 5:72490147-72490169 GTCAGAGAAGGGAAGTCAACAGG 0: 1
1: 0
2: 1
3: 9
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992007251 Original CRISPR TTGAAGCCTGGAACTTGTGG AGG (reversed) Intronic
901011900 1:6206879-6206901 CCGAAGCCTGCAACTTCTGGCGG - Intronic
904236055 1:29118002-29118024 TTGAAGGCTTGATTTTGTGGTGG + Exonic
905234258 1:36534980-36535002 CTCAAGCCTGGAACGGGTGGTGG - Intergenic
906388184 1:45390172-45390194 TGGAATCCTGGCACTTGGGGAGG + Intronic
906771174 1:48486122-48486144 TTGAAGCTAGGAAGTTGTTGGGG + Intergenic
906946670 1:50300554-50300576 TACAAGCCTGGTACTTGTTGTGG + Intergenic
907313126 1:53551345-53551367 GTGAGGCCTGGAAACTGTGGTGG + Intronic
910881754 1:91928099-91928121 TTGAAAGCAGGAACTTGTGCTGG - Intergenic
911944814 1:104093609-104093631 TTGAAGCCAGGAGTTGGTGGGGG + Intergenic
912633582 1:111270742-111270764 GGGAATCCTGAAACTTGTGGTGG - Intergenic
913526536 1:119699067-119699089 TTAGAGCCTGGAATTTTTGGGGG + Intronic
914380112 1:147108131-147108153 TGGGAGCCTGGACCTGGTGGGGG + Intergenic
915245912 1:154556290-154556312 TTGAAGTCTAGAACTTGTATAGG - Intronic
915365567 1:155313573-155313595 TTCCAGTCTGGAACTTGTCGGGG + Intronic
917152440 1:171959488-171959510 TGCAAGCCTGCAGCTTGTGGGGG + Intronic
917387341 1:174491531-174491553 TTGCAGCCTGGAGCTGGAGGAGG + Intronic
919293657 1:195666435-195666457 TTAACTCCTGGAACTTGAGGTGG - Intergenic
920109783 1:203579349-203579371 TTGAACCCTGGAGGTGGTGGAGG + Intergenic
922617980 1:226974351-226974373 TTAGAGCCTGGAGCTTGTGCTGG + Intronic
923204106 1:231741560-231741582 ATGAGGCCTTGAACATGTGGAGG + Intronic
924110230 1:240691671-240691693 CAGAAGCCTGGAATTTGTGAAGG - Intergenic
924288320 1:242510951-242510973 TTTAAGAGTGGACCTTGTGGGGG + Intronic
924749937 1:246877272-246877294 TTGAAGCCTGGAATTTTTTGCGG - Exonic
1062816051 10:500831-500853 CTGAAGCCTGAAACCTATGGGGG - Intronic
1065377676 10:25059697-25059719 TGTAAGCCTGGAACTTTGGGAGG + Intronic
1066640838 10:37552602-37552624 TTGAACCCAGGAACAGGTGGGGG + Intergenic
1067475702 10:46564513-46564535 TCCAAGCCTGGGACCTGTGGAGG - Intergenic
1067619035 10:47777262-47777284 TCCAAGCCTGGGACCTGTGGAGG + Intergenic
1069686025 10:70319301-70319323 TTCAATCCTGGAACATGTGAGGG - Intronic
1070140457 10:73734148-73734170 TTGGTGCCTGGAGCTGGTGGAGG - Intergenic
1070420851 10:76235695-76235717 TAGAAGCTTGGAATTTCTGGGGG + Intronic
1071325281 10:84509696-84509718 TTTAATCCTGAAACTTGTGGAGG - Intronic
1072030411 10:91515634-91515656 TTGAAGCCTTAAAATTGTGTTGG + Intergenic
1073484679 10:103809211-103809233 TAGAAGCCTGGATGTAGTGGAGG + Intronic
1075541799 10:123319744-123319766 TTATAGACTGGAACTTTTGGAGG + Intergenic
1077070128 11:666069-666091 TTTAAGCCTCTAACTTGTGAAGG - Intronic
1078874842 11:15382840-15382862 TTCAAGCCTGGAAGTCTTGGAGG - Intergenic
1079083767 11:17431132-17431154 TTGAAGTCCTGAACTTGTTGGGG - Intronic
1079127567 11:17729960-17729982 CTGAAGCCTGGAAGTTTTGGGGG - Intergenic
1082013214 11:47464939-47464961 ATGAAGCCTGGAACATGTAGTGG + Intergenic
1082094848 11:48121404-48121426 TTCAAGCCTGGGATTTCTGGTGG + Intronic
1087912280 11:103767901-103767923 GTGAGGCATGGAAGTTGTGGGGG + Intergenic
1090392864 11:126400739-126400761 AGGAAGCCTGTAACTTGGGGTGG + Intronic
1092507370 12:9117395-9117417 TTGAACTATGGAATTTGTGGTGG + Intergenic
1095337584 12:41047465-41047487 TTGAAGGCTGCACCTGGTGGAGG + Intronic
1096161063 12:49378051-49378073 TTGAACCCTGGAGCTGGAGGTGG - Intronic
1096733490 12:53633716-53633738 TTGAAGCCAGGACTTTTTGGGGG - Intronic
1097659169 12:62409204-62409226 TGGGAGCCTGGAACTTGTCAGGG + Intronic
1101689408 12:107061940-107061962 TTGAACCCTGGAAGTGGAGGCGG + Intronic
1102081852 12:110104589-110104611 ATGAAGCCTGGAGCTGCTGGTGG + Intergenic
1103235693 12:119370677-119370699 TTTAAGCCTGGAACTGGTGGGGG + Intronic
1103641342 12:122355092-122355114 GTGAAGTCTGGACCTTGTTGCGG - Intronic
1104248815 12:127069751-127069773 TTTAATCCTGGAACTTTGGGAGG - Intergenic
1104468469 12:129008843-129008865 TTAATCCCTGGAACCTGTGGAGG - Intergenic
1105928551 13:25031391-25031413 TTTGATCCTGGCACTTGTGGTGG - Intergenic
1106493806 13:30255393-30255415 TTGAAGCCCAGGACTTTTGGTGG - Intronic
1107861432 13:44664766-44664788 GTCAAGCCTGGAACTTCTGCTGG - Intergenic
1109469544 13:62787777-62787799 TAAAAGCCTGGAACTCTTGGGGG + Intergenic
1114899525 14:27039402-27039424 TTGAAGTAGGAAACTTGTGGGGG + Intergenic
1117649643 14:57889885-57889907 CTGAAGCTTGGCACTTGTAGTGG - Intronic
1119071184 14:71586250-71586272 TTAAAGGCTGGAACATGTAGGGG - Intronic
1119206703 14:72799740-72799762 GTCAATCCTGGAACTTCTGGGGG + Intronic
1122193220 14:100064827-100064849 TTGAACCCAGGAAGCTGTGGTGG + Intronic
1122356357 14:101125263-101125285 TGGAAGCCTGAAACTTGGGTAGG + Intergenic
1125593908 15:40872552-40872574 TTGGAGCCTGGGACTGATGGTGG - Exonic
1134522350 16:14924532-14924554 ATGGAGGCTGGAACTGGTGGAGG - Intronic
1135586478 16:23675663-23675685 TTAAAGCCTGGCACCTGGGGAGG + Exonic
1135598080 16:23758499-23758521 TAGAAGCCTGGAGCTGATGGTGG - Exonic
1137561030 16:49502594-49502616 TTGAAGCAAGGAAGGTGTGGGGG - Intronic
1138526041 16:57607815-57607837 TGCAAGCCTGGGACTTGTAGGGG + Intergenic
1140234716 16:73147792-73147814 CTGCAGCCTGGAACTCCTGGGGG - Intergenic
1142694121 17:1623907-1623929 TGGAAGCCTGGAGGTTGAGGAGG - Intronic
1146362096 17:32185486-32185508 TTGAAGCCAGGAAGTCGAGGGGG - Intronic
1147623835 17:41886295-41886317 TTGATGCCTCCAACCTGTGGGGG + Exonic
1148516590 17:48224197-48224219 CTGATGCCTGGAGCTTTTGGTGG + Intronic
1149596613 17:57868120-57868142 TTCCAGCCTGGCACTGGTGGGGG - Intronic
1150857049 17:68763296-68763318 ATGAAGCCTGGAAGTTCTGCAGG + Intergenic
1154982002 18:21510131-21510153 TTGAACCCGGGAGCTGGTGGCGG + Intronic
1156129242 18:33949477-33949499 TGGAGGCCTGGAACTGCTGGTGG + Intronic
1156346365 18:36260521-36260543 TGGCAGTCTGGAGCTTGTGGAGG + Intronic
1157539901 18:48493469-48493491 TGGAAGCCTGGAGCTGCTGGTGG - Intergenic
1161964582 19:7541100-7541122 TTGGAGCCTGGAATGGGTGGGGG - Intronic
1165340262 19:35206324-35206346 TCTAAGCCTGGAACTGCTGGAGG + Intergenic
1165358900 19:35321380-35321402 CTGCAGCCTTGAACTTGAGGTGG - Intronic
925474656 2:4199632-4199654 TTGTAGCCTGGAAAATGGGGTGG + Intergenic
926801500 2:16664633-16664655 TGGAAGGCTGGGACTTGTGCTGG - Intronic
927326987 2:21816279-21816301 TTGAAGCCTAGCACTTTGGGAGG - Intergenic
927856727 2:26532373-26532395 CTGAAGCCTGGTACTGCTGGGGG + Intronic
932099110 2:68880339-68880361 TTGTTCTCTGGAACTTGTGGTGG + Intergenic
933251950 2:80038763-80038785 TTGAACCCAGGAAGTGGTGGAGG + Intronic
933945046 2:87278845-87278867 GTGCAGCCTGGAACTTGCGCAGG + Intergenic
936234435 2:110731436-110731458 TTAAAGTATGGATCTTGTGGTGG + Intergenic
936335161 2:111582745-111582767 GTGCAGCCTGGAACTTGCGCAGG - Intergenic
941118832 2:161504989-161505011 TTGAAGCCTGGAATTTTTTGCGG - Intronic
942709835 2:178821157-178821179 TTTAAGCCTGGGACTTTTGGGGG + Intronic
943757082 2:191568037-191568059 TTGAACCCTGGAGGTAGTGGAGG + Intergenic
945545897 2:211151307-211151329 TTGAACCCTTGAACATGTGGTGG - Intergenic
947486614 2:230555850-230555872 TTCTAGCCTGGAACTTTTCGAGG - Intergenic
1170026363 20:11892383-11892405 TTAAAGCCAGTAACCTGTGGGGG - Intronic
1173031506 20:39365382-39365404 TTTAAGCCTGAAAAGTGTGGAGG + Intergenic
1174674270 20:52338069-52338091 TTGATTCCTGGAAAATGTGGAGG + Intergenic
1175867774 20:62190420-62190442 GGGAAGCCTGGATCTTGAGGAGG - Intronic
1179635015 21:42703294-42703316 TTGAAGTCTGGGACTTGGTGAGG + Intronic
1184878933 22:47292811-47292833 GTGAGGCCTGGAACTTCAGGCGG + Intergenic
1184953190 22:47860761-47860783 CTGGAGGCTGGAAGTTGTGGTGG - Intergenic
950527689 3:13533993-13534015 TTGAGGCCAGGAATTTGAGGTGG + Intergenic
951522237 3:23620804-23620826 TTGAAGCCTGGAGCTAGCTGGGG - Intergenic
951731937 3:25819508-25819530 TTAAAGCCTCGAATTTGTGATGG + Intergenic
952282548 3:31937728-31937750 TTGAAACCTGGAACTCTTGATGG + Intronic
952795840 3:37238380-37238402 ATGAAGACTGAAACTAGTGGCGG + Intergenic
954018279 3:47715106-47715128 CTGAACCCAGGAACTTTTGGAGG - Intronic
960260295 3:115560250-115560272 TGGAAGCCTGCATCTTTTGGGGG + Intergenic
963298563 3:143574361-143574383 GTGAAGCATGGAACTCGTGCTGG - Intronic
967840979 3:194004190-194004212 TTAGAGACTGGACCTTGTGGCGG - Intergenic
968812528 4:2806361-2806383 TGGGAGCCAGGAACTTGGGGTGG + Intronic
969970354 4:11040582-11040604 TTGAACGCTGCAACTTCTGGAGG + Intergenic
971217430 4:24674174-24674196 CTGAAGCCAGGAACCTGTAGGGG - Intergenic
974780141 4:66543863-66543885 CTGAAGCCAGCAACTTTTGGAGG - Intergenic
977252809 4:94707709-94707731 TTCAAGACTTGAATTTGTGGGGG - Intergenic
977564371 4:98566678-98566700 TGGAAGCCTGGATGCTGTGGAGG + Intronic
978871712 4:113586275-113586297 TGTAAGCCTGGAACTGCTGGAGG + Intronic
979702230 4:123682843-123682865 TCGAAGCCTGGTACATGTGCTGG - Intergenic
981219260 4:142212720-142212742 TAGAATCCTGGTTCTTGTGGTGG - Intronic
981725410 4:147842356-147842378 TTGTAGCCTGGTTCTTTTGGTGG + Intronic
981732141 4:147910866-147910888 TTGTAGCCTGGCACTGGTGATGG + Intronic
981735991 4:147950890-147950912 TTTAAGCCTGGAAATTGTAATGG + Intronic
984358509 4:178696680-178696702 CTGCAGCCTGGAACCTCTGGAGG + Intergenic
984655886 4:182318054-182318076 TTGAAGTCTGGTTATTGTGGGGG + Intronic
986647389 5:9930682-9930704 TTGGAGACTGGACTTTGTGGAGG - Intergenic
987213360 5:15707559-15707581 TTGAAGCCAGGAACTTTGTGAGG + Intronic
988831153 5:34988555-34988577 GTGAAGCCTGGGACTTGGTGGGG + Intergenic
990954551 5:61330417-61330439 CTGCAGCCTGGGACTTGTGAAGG + Intergenic
991739798 5:69658507-69658529 CTGAAGCCTTTAACTTGTGTTGG + Intergenic
991757701 5:69894670-69894692 CTGAAGCCTTTAACTTGTGTTGG - Intergenic
991791373 5:70238248-70238270 CTGAAGCCTTTAACTTGTGTTGG + Intergenic
991819261 5:70534632-70534654 CTGAAGCCTTTAACTTGTGTTGG + Intergenic
991837104 5:70770552-70770574 CTGAAGCCTTTAACTTGTGTTGG - Intergenic
991883822 5:71238590-71238612 CTGAAGCCTTTAACTTGTGTTGG + Intergenic
992007251 5:72490110-72490132 TTGAAGCCTGGAACTTGTGGAGG - Intronic
992709886 5:79441391-79441413 TTGAGGCATGGAACTTGGGGAGG + Intronic
993050485 5:82920770-82920792 TTGCAGACTGGAATTTCTGGTGG + Intergenic
996974309 5:129412303-129412325 CTGAAGCCTTGAACTCCTGGGGG + Intergenic
998611489 5:143694139-143694161 TCCAAGCCTGGAAGTTGTTGAGG + Intergenic
1000116403 5:158158002-158158024 TTGCAGCCTGGAATTTCTGCTGG + Intergenic
1001100450 5:168809772-168809794 CAGAAGCCTGGCACATGTGGAGG + Intronic
1004757741 6:18631324-18631346 CTGAGGACTGGATCTTGTGGGGG - Intergenic
1005550194 6:26904405-26904427 CTGAAGCCTTTAACTTGTGTTGG + Intergenic
1008235157 6:49037564-49037586 TTGAGCCCAGGAATTTGTGGTGG - Intergenic
1012018924 6:93891227-93891249 TGGAATCCTGGCACTTTTGGAGG + Intergenic
1012817076 6:104037594-104037616 TTAAAACATGGAACTTGAGGAGG - Intergenic
1014970889 6:127813692-127813714 TTGATGCCTGGTACTTTTTGTGG + Exonic
1018274638 6:162117684-162117706 ATGGAGCCTGGAACCTGTGTTGG - Intronic
1018642087 6:165913936-165913958 TTATGTCCTGGAACTTGTGGAGG - Intronic
1018795237 6:167180151-167180173 ATGATGCCTGGAGGTTGTGGAGG - Intronic
1018821083 6:167374911-167374933 ATGATGCCTGGAGGTTGTGGAGG + Intronic
1018916237 6:168134260-168134282 CTGAACCCTGGAAAGTGTGGTGG + Intergenic
1020916477 7:14200041-14200063 TTTAAGTCTAGAACTTCTGGAGG + Intronic
1021083401 7:16390193-16390215 TGGAAGTCTGGAAATTGAGGAGG - Intronic
1021822036 7:24507879-24507901 TTGTTGCCAGGAACTGGTGGGGG + Intergenic
1023528096 7:41126176-41126198 TTGAACCAGGGTACTTGTGGTGG + Intergenic
1024835838 7:53517304-53517326 GAGAAGCCTGGAACTTGGAGGGG + Intergenic
1027261357 7:76466979-76467001 TTGAACCCAGGAATTTGGGGCGG - Intronic
1027312740 7:76965088-76965110 TTGAACCCAGGAATTTGGGGCGG - Intergenic
1030032118 7:105379074-105379096 TTGAGGCCAGGAATTTGAGGTGG + Intronic
1030305021 7:108008940-108008962 TGTCAGCCTGGAACTGGTGGAGG + Intergenic
1034055897 7:148034707-148034729 TAGAAGCCTGGAAAATTTGGAGG + Intronic
1038103245 8:24404042-24404064 CTGAAGCCTGGAACTGATTGCGG + Exonic
1038670811 8:29581389-29581411 TTGAAGCATGAAAGTTTTGGAGG - Intergenic
1039504394 8:38041485-38041507 TTGAGGTCTGGCCCTTGTGGAGG - Intronic
1039958008 8:42221973-42221995 TTGGACCCTGGAACCTGGGGTGG + Intergenic
1044293711 8:90502913-90502935 TGGAACCCTGGAACTCCTGGTGG - Intergenic
1044924334 8:97197164-97197186 TTGAAGCCTGCTGCTTTTGGAGG - Intergenic
1045703089 8:104889484-104889506 GTGAAGCCCTGAACTTGTGTTGG + Intronic
1046662194 8:116960020-116960042 TTGAAGCCTCGAACTTCTTAAGG + Intronic
1051145100 9:14018837-14018859 TTGATGCCATGAACTTCTGGAGG + Intergenic
1052532086 9:29699304-29699326 ATGTAGCCTGGAACGTGTAGTGG - Intergenic
1054904578 9:70403418-70403440 TTAAAGCCTGGAACTTTTGCTGG + Intronic
1057024004 9:91722275-91722297 CTGGAGCCTGGCACTTCTGGGGG - Intronic
1059278086 9:113111898-113111920 TTGAAGCCTGCAGAATGTGGTGG - Intergenic
1060555809 9:124506719-124506741 CTGGAACCTGGAACCTGTGGGGG - Intronic
1061736752 9:132666600-132666622 TTGAACCCAGGAACCAGTGGAGG - Intronic
1185867414 X:3636340-3636362 TTGAACCCAGAAACTTCTGGTGG - Intronic
1187750901 X:22463870-22463892 CTGAAGGCTGGAAATTCTGGGGG - Intergenic
1189492707 X:41482337-41482359 TTGAATCCAGGAATTTGAGGTGG + Intergenic
1190310600 X:49114522-49114544 TTGAAACCAGGAATTTGAGGTGG + Intronic
1192104059 X:68296150-68296172 TTGAAAGCTGGGAATTGTGGTGG - Intronic
1192406149 X:70887859-70887881 TGGAAGCCTGGATCTGGGGGAGG - Intronic
1192978065 X:76307201-76307223 GTGCAGCCTGGGGCTTGTGGAGG + Intergenic
1195282003 X:103345208-103345230 TTGAGTCATGGAACTTTTGGGGG + Intergenic
1195792718 X:108606778-108606800 TTGAAACCTGGAAGTCCTGGTGG - Exonic
1200796575 Y:7346352-7346374 TTGAACCCGGAAACTTTTGGTGG + Intergenic