ID: 992007735

View in Genome Browser
Species Human (GRCh38)
Location 5:72495050-72495072
Sequence GAAGTTTCCCTCATTGATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992007734_992007735 11 Left 992007734 5:72495016-72495038 CCAGGGGATGGAATCTTGGAAGA 0: 1
1: 0
2: 0
3: 16
4: 244
Right 992007735 5:72495050-72495072 GAAGTTTCCCTCATTGATGTTGG 0: 1
1: 0
2: 1
3: 6
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992007735 Original CRISPR GAAGTTTCCCTCATTGATGT TGG Intronic
900809159 1:4788035-4788057 TGAGTTTCGCTCATTTATGTGGG - Exonic
900921885 1:5677941-5677963 GATGATTCCCTCATTGAAGGTGG - Intergenic
902805973 1:18861653-18861675 GAAGTTACCCTGAAGGATGTTGG + Intronic
906801438 1:48740781-48740803 GAAGTAGCCCTCATTGTTCTTGG - Intronic
907549289 1:55290673-55290695 CAAATTTCCCTCAATAATGTGGG - Intergenic
908199461 1:61779447-61779469 AAAATTACCCTCAATGATGTAGG - Intronic
913482994 1:119307147-119307169 GAGGTTACCCTCAGTAATGTGGG + Intergenic
915034946 1:152913964-152913986 AAAGTTTCCATCATTGAGGATGG + Intergenic
915517624 1:156422307-156422329 GATCTTTCCCTCATTGTTTTGGG - Intronic
915745830 1:158156936-158156958 GGAGTTTCCCTTAGTGATTTTGG - Intergenic
919656451 1:200201603-200201625 GAAATTACCCTCAATCATGTGGG + Intergenic
919737553 1:200962560-200962582 GAAATTTCCCCCATTAATGTTGG + Intergenic
922020369 1:221698417-221698439 GAAGTCACCCCCATTGAGGTTGG + Intergenic
1063485239 10:6414120-6414142 GAAGGTTCCCTGAGTCATGTAGG + Intergenic
1064319468 10:14289661-14289683 GAAGTTTTCATCATTGATGATGG - Intronic
1064637539 10:17385103-17385125 GGAGTTTCCCTTAGTGATTTTGG - Intronic
1071342901 10:84664830-84664852 GAAATTCCCCTCAGAGATGTAGG - Intergenic
1074304616 10:112265201-112265223 GAAGTTTCCCTCGATAATATTGG - Intergenic
1076454574 10:130581017-130581039 GATGGATCCCTCATAGATGTGGG + Intergenic
1079703448 11:23580752-23580774 GAAGTTTCCTTCCTTTAAGTGGG + Intergenic
1087725087 11:101707601-101707623 GACATTTCCCTCATTGTTTTGGG - Intronic
1088999510 11:115039645-115039667 GTAGTATCCCTCTTTGAAGTTGG - Intergenic
1091876392 12:3937285-3937307 GAAGTTTCATTCATTGGTGGCGG + Intergenic
1092699397 12:11210585-11210607 GAACTTTCCTTCATTGCTGGTGG + Intergenic
1097183081 12:57181929-57181951 GGAGCCTCCCTCTTTGATGTGGG + Intronic
1098020685 12:66152586-66152608 AAAGTTTCCCCCATTCATTTTGG - Intronic
1099440159 12:82688539-82688561 GAATTTTCCCTAATGGATATAGG - Intronic
1100134572 12:91539254-91539276 GATGCTTCCTTTATTGATGTAGG + Intergenic
1104052702 12:125206812-125206834 CAAGTTTCTCACATTGATGAAGG - Intronic
1104341424 12:127953179-127953201 GAAGTCTCCTTCATTGTTGATGG + Intergenic
1107857020 13:44626345-44626367 GAGGTTACCCTCAATAATGTGGG + Intergenic
1107907623 13:45075939-45075961 GAAATTTACCTCTTTTATGTAGG - Intergenic
1108023866 13:46158112-46158134 GAAGTTTCCATTATGGCTGTTGG + Intronic
1108999639 13:56781253-56781275 GAAAATTCTCTCTTTGATGTTGG - Intergenic
1109157852 13:58933826-58933848 GAAAGTTAGCTCATTGATGTGGG - Intergenic
1109375103 13:61482388-61482410 GAACTTTCATTCATTGATGGTGG + Intergenic
1110023823 13:70510231-70510253 GATGTTTGTCTCATTGGTGTGGG - Intergenic
1111742867 13:92226648-92226670 GGAGTTTCACTCACTGATCTCGG + Intronic
1115212611 14:30982711-30982733 GAAGTTTACCCCCTTGAGGTAGG + Intronic
1116441118 14:44954160-44954182 GAAATCTCACTCATTGCTGTGGG + Intronic
1117779179 14:59214954-59214976 GAACTTTCACTCATTGCTGGTGG - Intronic
1119514607 14:75238249-75238271 AAAATTTTCCTCAGTGATGTAGG - Intergenic
1124194940 15:27616475-27616497 GAAGTTTCATTCATTGCTGGTGG + Intergenic
1127755204 15:62085430-62085452 GAAGTTGCTCTGATTGATGATGG + Intergenic
1128514402 15:68333509-68333531 GATGTTGCCCTCACTGAAGTGGG - Intronic
1129386637 15:75200057-75200079 GCAATTTCCCACACTGATGTTGG + Intronic
1131792262 15:95978005-95978027 CAGGTTTCCATCAGTGATGTGGG + Intergenic
1131918915 15:97301794-97301816 GCAGTTTGGCTCATTGATGGTGG + Intergenic
1131919138 15:97303611-97303633 GCAGTTTGGCTCATTGATGGTGG - Intergenic
1135824703 16:25716426-25716448 GAAGCTCCCCTCTTTGCTGTTGG + Intronic
1136639129 16:31547019-31547041 AAAGATTCCCTCAGTGATATTGG + Intergenic
1136665532 16:31808606-31808628 AAAGATTCCCTCAGTGATATTGG - Intergenic
1139841057 16:69881060-69881082 CAAGGTTCCCTCTGTGATGTTGG - Intronic
1140250911 16:73293553-73293575 GAAGATTCCCCCATGGATCTGGG + Intergenic
1141059415 16:80852213-80852235 GAAGTGTTCTTCATTGACGTTGG - Intergenic
1141293258 16:82740793-82740815 GAATGTTCCCCCATTGATATTGG - Intronic
1146306887 17:31736866-31736888 GACTTTTCCCTCTTTGAAGTAGG - Intergenic
1147880755 17:43651882-43651904 GATCTTTCCCTCTTCGATGTTGG + Intronic
1148194300 17:45702189-45702211 GAGCTTTCCCTTGTTGATGTTGG - Intergenic
1149415201 17:56452232-56452254 GGAGTTTACTTCATTCATGTTGG - Intronic
1153337371 18:3938547-3938569 CAAGTCTCCCTCATAGAAGTAGG - Intronic
1155025388 18:21935920-21935942 GAAGTGTCCCTCATGGAGGGGGG - Intergenic
1160238147 18:77102005-77102027 GAAAGTTCCCTCCTTGATATAGG + Intronic
1161866460 19:6836273-6836295 GAATTTTCACTCATTGCTGGTGG - Intronic
1161897961 19:7096827-7096849 GGAGTTTCCATCATTAATGTAGG - Intergenic
1163363127 19:16860503-16860525 GACGTCCCCCTCATTGATGTGGG - Intronic
1166956884 19:46470815-46470837 AAAGCTGCCCTCATTGAGGTTGG - Exonic
925030373 2:646019-646041 AAAGATTACCTCACTGATGTGGG - Intergenic
927337814 2:21945709-21945731 GAAGTTTCACTAATTGAAGTAGG - Intergenic
927437318 2:23077992-23078014 GAACTGGCCCTCATTGCTGTGGG - Intergenic
928184638 2:29098822-29098844 GAACTTTCACTCATTGCTGGTGG - Intronic
931068608 2:58618193-58618215 GAGTTTTGCCTCATTGATCTTGG + Intergenic
931180050 2:59890574-59890596 GAAGTTTCCATGATTACTGTGGG + Intergenic
931859316 2:66337580-66337602 GAAGTTGGGCACATTGATGTGGG - Intergenic
933543137 2:83673811-83673833 AAAGTTGCCTTCAATGATGTTGG + Intergenic
942647047 2:178123614-178123636 GGTGTTTCCTTCATTGATGATGG + Exonic
946916445 2:224527875-224527897 GAATTTTCCCTCTTGGGTGTGGG - Intronic
947325269 2:228967771-228967793 AAAGCTTCCATCACTGATGTGGG + Intronic
1170399831 20:15969797-15969819 GAAATTTCCCACACTGATGAAGG + Intronic
1172480273 20:35267355-35267377 GAAGTTGCCGTCACAGATGTTGG - Exonic
1173057579 20:39630709-39630731 AAAGTTTCTCTCATTGATTCTGG - Intergenic
1175406302 20:58732686-58732708 GAAGTTTAGATCATTGATTTGGG - Intergenic
1175557212 20:59873904-59873926 GAAGTTTTTCTCATTGTTTTTGG + Exonic
1178278681 21:31262103-31262125 GAAGATTGCCTCATTGTTCTAGG - Intronic
1182498940 22:30731659-30731681 GGAGATTCCCACATTGAAGTAGG - Intronic
1183875552 22:40777299-40777321 CACATTTCCCTCATTGCTGTTGG - Exonic
1185293819 22:50042866-50042888 GAACTCTCCCTCATTGCTGGTGG + Intronic
951142784 3:19185991-19186013 GATGTTACCCTCATAGTTGTTGG + Intronic
951987737 3:28639736-28639758 GAAATTACCCTCAATAATGTTGG - Intergenic
952055297 3:29436908-29436930 AAAGTTTCACTAATTGATGAGGG + Intronic
952697558 3:36286642-36286664 GAAGTTTCACTTGTTGATATAGG + Intergenic
962243132 3:133768122-133768144 GTAGTATCCCTCTTTGTTGTTGG - Exonic
964380874 3:156097967-156097989 TAATTCTCCCTCCTTGATGTGGG - Intronic
964645687 3:158956585-158956607 GGAGTGTCTCTCATTTATGTTGG - Intergenic
965848810 3:172996406-172996428 AAAGTTTTGCTCATTGATTTTGG + Intronic
971712840 4:30138915-30138937 GAAATTTGCCTCACTGATGCAGG - Intergenic
972073295 4:35051634-35051656 GTAATTTCCCTCATTTATTTTGG - Intergenic
973289113 4:48452725-48452747 GAACTTTCATTCATTGCTGTTGG + Intergenic
974597434 4:64032638-64032660 GAACTTTCACTCATTGCTGGTGG + Intergenic
974977123 4:68905353-68905375 GCAGCATCCCTCATGGATGTGGG - Intergenic
977267315 4:94870834-94870856 GGAGTTTCCCACATTAACGTTGG + Intronic
977346847 4:95826843-95826865 GAAGTTGCTCTCAATGATTTTGG - Intergenic
977531355 4:98204012-98204034 GAAGTCTCCCTCAGTGCTTTGGG + Intergenic
978376551 4:108080281-108080303 GCAGTTTCCCTCCTTTGTGTTGG - Intronic
982454913 4:155597896-155597918 GGAGTTTTCTTCATTCATGTAGG - Intergenic
982776986 4:159452309-159452331 GAAGTTGATCTCATAGATGTAGG + Intergenic
991316898 5:65319274-65319296 GAAGTTTGAATCATTGATTTTGG - Intronic
992007735 5:72495050-72495072 GAAGTTTCCCTCATTGATGTTGG + Intronic
994607622 5:101989419-101989441 GAAGATGCCATCATTGTTGTAGG - Intergenic
995991517 5:118245799-118245821 CAAGTTTCCTTCATTGACCTTGG + Intergenic
1001457839 5:171879554-171879576 GAACTTTCATTCATTGCTGTTGG - Intronic
1002993666 6:2261909-2261931 GAATTTTCATTCATTGATGGTGG - Intergenic
1004997883 6:21211726-21211748 GAAGTTTCTATCATGCATGTGGG + Intronic
1005129253 6:22485773-22485795 GAACTCTCCTTCATTGATTTTGG + Intergenic
1005233260 6:23729546-23729568 GAACTTTCATTCATTGCTGTTGG + Intergenic
1005282902 6:24293571-24293593 GAAGTTTCCCACTATTATGTGGG - Intronic
1008165581 6:48134393-48134415 GAACTTTCCTTCAGTGTTGTGGG + Intergenic
1009666615 6:66689764-66689786 GAATTTACCCTCAGTCATGTGGG + Intergenic
1010217533 6:73417835-73417857 TAAGTTACCCTCATTTATGGTGG - Intronic
1013139363 6:107316214-107316236 GATGCTTACCTCATTCATGTGGG - Intronic
1013588766 6:111602817-111602839 CAAGTATCCCTCATTGCTGAGGG + Intronic
1015242395 6:131039964-131039986 TAGCTTTCCCTCATTAATGTGGG - Intronic
1015992775 6:138964283-138964305 GAATTTTCCCTCACTGAGGTAGG - Intronic
1018303310 6:162426862-162426884 TAAGTTTTCCACATTAATGTGGG + Intronic
1018449598 6:163894941-163894963 TAAGTTTCTCTAATTAATGTGGG + Intergenic
1020953575 7:14710570-14710592 GAAGTTTCTCTCATTGATATTGG - Intronic
1024131247 7:46354856-46354878 GAAATTTACCCCATTGCTGTGGG - Intergenic
1028639359 7:93026044-93026066 TGAGTGTCCCTCATTCATGTGGG - Intergenic
1029495293 7:100893177-100893199 GAAGTCTCCCGCGTTGATGAGGG + Exonic
1032913375 7:136459514-136459536 CAAGTTTCTCTCTTGGATGTTGG + Intergenic
1033343244 7:140508040-140508062 GAAATTTCCCTCAGTGAAGGTGG + Intergenic
1036814767 8:11893627-11893649 GAAGTTTTTCTCCTTCATGTTGG + Intergenic
1043296374 8:78668036-78668058 GAAGTTGCCCTAAATTATGTAGG + Intronic
1043944487 8:86233872-86233894 CTAGCTTCCCTCATTAATGTGGG + Intronic
1045116461 8:98988252-98988274 AATGTTGGCCTCATTGATGTTGG + Intergenic
1057363947 9:94401106-94401128 GGAGTTTCGCTCTTTCATGTGGG + Intronic
1057659390 9:96986955-96986977 GGAGTTTCGCTCTTTCATGTGGG - Intronic
1185951628 X:4441660-4441682 GAATTTTGCCTAATTGATCTAGG - Intergenic
1186166257 X:6829488-6829510 GAACTTTCATTCATTGATGGTGG - Intergenic
1186887117 X:13925031-13925053 GAGTTTTCCCTCAGTGATGATGG + Intronic
1192088362 X:68125227-68125249 GAAGTTTTTCTTTTTGATGTAGG - Intronic
1193821788 X:86174045-86174067 GAAGTTTCCTTCATTTAGTTGGG + Intronic
1196784024 X:119406680-119406702 GGGGTTTCCCTCACTGTTGTAGG + Exonic
1197101452 X:122660835-122660857 GAAGTTTTCCGCATTGTTGATGG - Intergenic
1197304087 X:124819637-124819659 GAAGTTTCCTACAATTATGTAGG - Intronic
1198617581 X:138476546-138476568 GAAATTTCACTCATTGCTGGGGG + Intergenic
1198786810 X:140297775-140297797 GCATTTTCCCTTACTGATGTTGG + Intergenic
1199381657 X:147179473-147179495 GAAGTTACCTTCTTTGGTGTTGG + Intergenic
1201738354 Y:17296185-17296207 GAATTTTCCCTAATTGACCTAGG - Intergenic