ID: 992008429

View in Genome Browser
Species Human (GRCh38)
Location 5:72502409-72502431
Sequence GACACAGATCTCCCTCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992008429 Original CRISPR GACACAGATCTCCCTCTGAC AGG (reversed) Intronic
901762457 1:11479708-11479730 GACCCAGATATCCCTCAGAGGGG - Intronic
902342607 1:15793960-15793982 GACACAGGTCTCCCTCCAAAAGG - Intergenic
903013739 1:20348570-20348592 GACACAGTTCTCTCTTTGCCAGG + Intronic
905741292 1:40373797-40373819 GACGCAGATGACCCTCTGGCCGG - Exonic
906185420 1:43858779-43858801 GAGACAGGTCACTCTCTGACTGG + Intronic
906517238 1:46446922-46446944 TACTCAGACCTCCCTCTTACAGG - Intergenic
906554622 1:46698922-46698944 TACACAGATCTCCTTCTTACTGG - Intronic
908034700 1:60039396-60039418 GACACAAATTTCCCAATGACAGG - Intronic
911186667 1:94911333-94911355 GACACAGTTGTACCTCTGAGAGG - Intronic
911575740 1:99575512-99575534 CACTCAGATCTTCCTCTGAAGGG - Intergenic
912245099 1:107953645-107953667 GTCCCAGATCTGTCTCTGACAGG - Intronic
915477224 1:156160365-156160387 TCCACAGACCTGCCTCTGACTGG - Intronic
917740852 1:177960824-177960846 GTCCCAGCTCTCCCACTGACGGG - Exonic
922375749 1:224962990-224963012 AACACATATCTCACTCAGACTGG - Intronic
924603778 1:245514937-245514959 GAGACAGACCTACCGCTGACAGG - Intronic
1070830854 10:79417339-79417361 GCCACAGGTCTCTCCCTGACAGG - Intronic
1071435995 10:85648676-85648698 GCCACAGTGCTCCCTCTGCCTGG + Intronic
1072530444 10:96313794-96313816 GACACAGCCCTGCCTCTGATGGG - Intronic
1074485011 10:113867641-113867663 GACACAGTGTTCCCTCTGCCTGG + Intronic
1083111906 11:60418702-60418724 GATACAGAGCTCCTTATGACTGG + Intergenic
1083181172 11:60986656-60986678 GACACATCTCTCCCTCTTACGGG + Intronic
1084128865 11:67118733-67118755 GACGCAGATCTCCCACTGCTTGG + Intergenic
1084684493 11:70685770-70685792 GACACAAGTCTCCTTCTCACTGG + Intronic
1085442938 11:76579714-76579736 GACACAGCTCTGCCCTTGACGGG + Intergenic
1085772090 11:79334785-79334807 GAAACAGATCTCTTTATGACAGG - Intronic
1086164840 11:83765696-83765718 GACACAGCTCTCACTCTCATAGG - Intronic
1088071396 11:105790257-105790279 GTAACAGATGTCTCTCTGACAGG - Intronic
1090535664 11:127638492-127638514 GACAGACACCTCCCTCAGACTGG - Intergenic
1092023439 12:5221670-5221692 TACACACAGCTCCCTCTGGCTGG + Intergenic
1095586686 12:43857855-43857877 GGCACAGATCTCTCTATGATGGG - Intronic
1096240436 12:49956937-49956959 GACTCAGATCTGCCTCTGCCTGG - Exonic
1101859856 12:108474300-108474322 CACACAGAACTCTCTCTGAATGG + Intergenic
1102408260 12:112693297-112693319 GACACAGCTGTCACTCTGGCTGG + Intronic
1103324548 12:120111762-120111784 GACACTGCTCTCCCTTTGAGAGG + Intronic
1106182390 13:27380753-27380775 GACACAGGTCTCCCTCCCAGGGG - Intergenic
1107130531 13:36889540-36889562 AATATAGATCTCCCTCTAACAGG + Intronic
1107417623 13:40216176-40216198 TAGAGAGATCTCCCTCTGGCAGG - Intergenic
1108792950 13:53995004-53995026 GACACAGATTTCCTCCTGCCTGG + Intergenic
1113806541 13:113113428-113113450 GCCACAGCTCCACCTCTGACAGG - Intronic
1115643903 14:35353569-35353591 GATACAGAGCTCCGTCTGCCTGG - Intergenic
1116019907 14:39447640-39447662 AAACCAGATCTCCCTCTCACTGG - Intergenic
1117339528 14:54781631-54781653 GACTCACATCTCCATCTGCCTGG + Intronic
1117571036 14:57049456-57049478 GTCCCAGATTTCCCTCTGGCTGG - Intergenic
1121277863 14:92679849-92679871 GGCCCAGTTCTGCCTCTGACTGG + Intronic
1124053785 15:26223138-26223160 GACACAGATCTGGCTCAGAAAGG + Intergenic
1125876511 15:43151585-43151607 GTCACATAACTGCCTCTGACTGG - Intronic
1126258513 15:46657569-46657591 GGCACTGATATCCCTCTGCCTGG + Intergenic
1130109214 15:80950762-80950784 GATAGAGTTCTCCCTCTTACAGG - Exonic
1130345129 15:83036895-83036917 GTCACTAATCTCCCTCTGAAAGG - Intronic
1130385165 15:83404790-83404812 GACAAACAACTCCCTCTGTCTGG + Intergenic
1136359707 16:29770963-29770985 GAAACAGATCTCCCACTGTTTGG + Intergenic
1138246035 16:55467916-55467938 CACCCAGATCTGCCTCTGATTGG - Intronic
1140454814 16:75098826-75098848 GACACAGATCTGCACCTGGCTGG - Intronic
1140476210 16:75240334-75240356 GACACAGATGTCCCGCAGCCAGG + Intronic
1141813880 16:86396111-86396133 GTCTCAGCTCTACCTCTGACTGG + Intergenic
1145786706 17:27598362-27598384 GGCACAGCTCTCCCTGTGCCAGG + Intronic
1151400178 17:73850774-73850796 TCCACTGGTCTCCCTCTGACTGG - Intergenic
1153617911 18:6951462-6951484 GACACCGTGGTCCCTCTGACAGG - Intronic
1154981418 18:21505437-21505459 GCCAGGGCTCTCCCTCTGACTGG - Exonic
1155697978 18:28706666-28706688 CACACAGCTTTCCCTCTGACAGG - Intergenic
1156766932 18:40667852-40667874 AACACAAATCTCCCTCTCAAAGG - Intergenic
1157601620 18:48896683-48896705 GAGACAGTCCTCCCTCTGCCTGG - Intergenic
1158655181 18:59324422-59324444 AACACTGATCTTCCTCTGCCCGG + Intergenic
1160519505 18:79496400-79496422 GCCACCTCTCTCCCTCTGACGGG - Intronic
1166691640 19:44825024-44825046 TACACAGGTGTCCCTCTCACAGG + Intergenic
1168267240 19:55229650-55229672 GCCACAGGGCTCCCTCTGGCAGG + Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
925532481 2:4880092-4880114 GACACAGCTCTGCCTCTCTCAGG + Intergenic
926529018 2:14018568-14018590 GACACAAATCTCCCTCTGACAGG + Intergenic
926542126 2:14193908-14193930 CCCTCAGATCTCCCTCCGACAGG - Intergenic
929529125 2:42735903-42735925 GACACATATCTCCATCTCTCTGG + Intronic
933084856 2:78043413-78043435 CACAAAGATCTCCCTCTTTCTGG + Intergenic
938043080 2:128091913-128091935 GACGCAGATCTCATTCTGGCAGG - Intronic
938225419 2:129611702-129611724 GACACAGATGTGCATCTGGCGGG - Intergenic
943585841 2:189739027-189739049 TACACAGATGTACCTCTGTCTGG + Intronic
943689755 2:190857590-190857612 CACACAGCACTCCCACTGACTGG + Intergenic
944062385 2:195583267-195583289 GACAAAGATGTCCTCCTGACAGG + Intronic
1168857403 20:1018439-1018461 GACTCAGATGTCCCTTTGCCAGG + Intergenic
1169911054 20:10647764-10647786 GACACGGCTCTCCCACTGGCAGG + Intronic
1171163629 20:22951535-22951557 GACACAGCTCAACCTCTGCCAGG - Intergenic
1172060865 20:32186537-32186559 GTCACAGATCCCCTTGTGACTGG + Intergenic
1172699283 20:36843065-36843087 GCCAGAGGTGTCCCTCTGACGGG - Intronic
1175385712 20:58593789-58593811 TAAACAGGTTTCCCTCTGACAGG + Intergenic
1178294498 21:31397698-31397720 TACACAGAGCTGCCTTTGACTGG - Intronic
1181691584 22:24565327-24565349 GGGACAGATCTGCCTCTGAATGG + Intronic
1182577848 22:31285173-31285195 GGCACAGCACTGCCTCTGACTGG - Intronic
1182782808 22:32881355-32881377 CACACATATCTCTGTCTGACAGG + Intronic
1183483066 22:38075366-38075388 GACCAAGCTCTCCCTCTGGCCGG - Exonic
1184032931 22:41905418-41905440 GACACACATCTCCTTCCCACAGG + Exonic
950621362 3:14208022-14208044 GACACAGAACTCAGTCTGAAGGG + Intergenic
955529350 3:59857094-59857116 GACACAGCACTTCCTCTGAGGGG + Intronic
956244424 3:67165714-67165736 GGCACAGATCTCCTTCACACAGG + Intergenic
956878823 3:73490170-73490192 GGCACACCTCTCCCTCTGAAAGG + Intronic
957632582 3:82736917-82736939 AGCACAGGTCTCCCTCTCACTGG + Intergenic
961994921 3:131232444-131232466 GACACAAATCTTCCTCGGAAGGG + Intronic
962085100 3:132182788-132182810 CACACAGATCACCCTCTGCAAGG + Intronic
964933624 3:162054991-162055013 CACTCAAATCTACCTCTGACTGG - Intergenic
970692588 4:18636632-18636654 AACACAGATCTCCCTGGGAATGG - Intergenic
974139025 4:57860150-57860172 CTCACACATCTCCCTCTGCCTGG + Intergenic
975557606 4:75680255-75680277 GAGACAGATTTCCTTCTGAGGGG + Intronic
976542180 4:86291105-86291127 GACCCAGTTCTCCCGCTGTCTGG - Intronic
976545956 4:86336011-86336033 GTCAGAGATGTCCCCCTGACTGG + Intronic
981915932 4:150033293-150033315 CACACCCATCTCCCTCTGAAAGG + Intergenic
982600523 4:157443570-157443592 AACACAGAACTGCCACTGACTGG + Intergenic
984567179 4:181345197-181345219 GAGAAATAGCTCCCTCTGACAGG - Intergenic
990677735 5:58207146-58207168 GCCACAGAACTGCCTCAGACAGG + Intergenic
992008429 5:72502409-72502431 GACACAGATCTCCCTCTGACAGG - Intronic
992826102 5:80551550-80551572 GACTCAGATCTTCCTAGGACAGG + Intergenic
1002289335 5:178188909-178188931 GGCACAGACCTCCATCTGCCTGG - Intergenic
1004456459 6:15796278-15796300 GACTCTGAGCTCCCTCTGCCTGG - Intergenic
1007737814 6:43992801-43992823 GACACTGCCCTCCCTCTGAGTGG - Intergenic
1010716230 6:79233642-79233664 GACACAAATCTCCCTCGGGGTGG - Intronic
1011497582 6:87951642-87951664 GCCACAGATCTCCATCTGGAGGG + Intergenic
1014978304 6:127916493-127916515 GACACAGAGGTCCTTCTGCCTGG + Intronic
1018799981 6:167214480-167214502 GGCACAGATCTCCCCTTGAGAGG + Intergenic
1018889088 6:167968830-167968852 GGCCCAGCTCTGCCTCTGACTGG - Intronic
1019853417 7:3582015-3582037 GAGACAGATCTACCTGAGACAGG - Intronic
1022264569 7:28741456-28741478 GAAACACATCTCTCTCTGAGTGG + Intronic
1023244302 7:38184263-38184285 GCCCCAGTTCTCCCTCTGCCTGG - Intronic
1023528969 7:41133852-41133874 GACTCTGTTCTCCTTCTGACAGG - Intergenic
1029171298 7:98630916-98630938 TACTCAGATCTCCCCCTGAAAGG + Intergenic
1029186460 7:98742245-98742267 GACACAGATGTCACACTGATGGG + Intergenic
1030708915 7:112726262-112726284 AACACAGACCTCCCACAGACGGG + Intergenic
1033463991 7:141574350-141574372 GAAAAAGTTCTGCCTCTGACTGG - Intronic
1034752888 7:153587367-153587389 GGCACAGATGTGCCTCTGGCTGG + Intergenic
1039181297 8:34870003-34870025 GACACAGTTTTCCCTCTGACAGG + Intergenic
1039295952 8:36155117-36155139 GACTCAGATCTATTTCTGACTGG - Intergenic
1039518602 8:38152991-38153013 GACACAGAACTCCCTCCCACAGG - Intergenic
1039627812 8:39072757-39072779 GGACCAGCTCTCCCTCTGACAGG + Intronic
1040586693 8:48750121-48750143 GACTCAGATCTGCCTCTGCCTGG - Intergenic
1044942381 8:97356495-97356517 GACACAGGCCTGCATCTGACTGG - Intergenic
1049666729 8:143847637-143847659 GACACTGAGCTTCATCTGACGGG - Intergenic
1052287292 9:26800559-26800581 GAAACTGATCTCTCTCTGAGAGG - Intergenic
1055648425 9:78382993-78383015 AATACAGATCGCCCTCTGAAGGG - Intergenic
1055663431 9:78530348-78530370 CACACATATCTCCATCTGATTGG - Intergenic
1056331666 9:85526174-85526196 GACCCAATGCTCCCTCTGACTGG + Intergenic
1057185684 9:93056396-93056418 GACACAGTTCAGCCCCTGACAGG - Intergenic
1058758152 9:108102961-108102983 GATACACCTCTCCTTCTGACTGG + Intergenic
1060262539 9:122089162-122089184 GACACAGCTCTCACTCTGGTTGG + Intronic
1061328378 9:129877717-129877739 GAGGCAGCTCTCCTTCTGACAGG - Intronic
1062566873 9:137167508-137167530 GTCTCAGCTCTCCCTATGACGGG - Intronic
1188696872 X:33204379-33204401 GAAACATTGCTCCCTCTGACAGG + Intronic
1195656677 X:107337907-107337929 AACACTAAGCTCCCTCTGACTGG + Intergenic
1196862667 X:120042389-120042411 GTCACAGATCTGCCACTTACTGG - Intergenic
1196880435 X:120193955-120193977 GTCACAGATCTGCCACTTACTGG + Intergenic
1198315506 X:135461899-135461921 GAAACAGATTTACCTCTCACAGG + Intergenic
1199212731 X:145232987-145233009 CACACAGATCTGCATCTCACAGG + Intergenic