ID: 992009368

View in Genome Browser
Species Human (GRCh38)
Location 5:72511526-72511548
Sequence CTGTAAAAAGGGCAGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992009368_992009376 -3 Left 992009368 5:72511526-72511548 CCATCCCCCTGCCCTTTTTACAG No data
Right 992009376 5:72511546-72511568 CAGATGAAGGAACTGAGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992009368 Original CRISPR CTGTAAAAAGGGCAGGGGGA TGG (reversed) Intergenic
No off target data available for this crispr