ID: 992013731

View in Genome Browser
Species Human (GRCh38)
Location 5:72556081-72556103
Sequence GGCCCCAGGGGGAAACCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992013731_992013741 4 Left 992013731 5:72556081-72556103 CCAGCAGGTTTCCCCCTGGGGCC No data
Right 992013741 5:72556108-72556130 CAGGCCACTCTCTTTAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992013731 Original CRISPR GGCCCCAGGGGGAAACCTGC TGG (reversed) Intergenic
No off target data available for this crispr