ID: 992019227

View in Genome Browser
Species Human (GRCh38)
Location 5:72605904-72605926
Sequence AAATCTAATCCCTTGTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992019227_992019232 10 Left 992019227 5:72605904-72605926 CCTCCATACAAGGGATTAGATTT No data
Right 992019232 5:72605937-72605959 TTGAAACAAACCAGCCCTTGAGG No data
992019227_992019234 20 Left 992019227 5:72605904-72605926 CCTCCATACAAGGGATTAGATTT No data
Right 992019234 5:72605947-72605969 CCAGCCCTTGAGGAATCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992019227 Original CRISPR AAATCTAATCCCTTGTATGG AGG (reversed) Intergenic
No off target data available for this crispr