ID: 992023583

View in Genome Browser
Species Human (GRCh38)
Location 5:72649465-72649487
Sequence CAGTGAGGGGCTTTGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992023583_992023593 28 Left 992023583 5:72649465-72649487 CCTTCTTCCAAAGCCCCTCACTG No data
Right 992023593 5:72649516-72649538 TTCCTGCCCCCACACACCCGAGG No data
992023583_992023594 29 Left 992023583 5:72649465-72649487 CCTTCTTCCAAAGCCCCTCACTG No data
Right 992023594 5:72649517-72649539 TCCTGCCCCCACACACCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992023583 Original CRISPR CAGTGAGGGGCTTTGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr