ID: 992029727

View in Genome Browser
Species Human (GRCh38)
Location 5:72709218-72709240
Sequence TGGTGCCCAAAGTTTCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992029718_992029727 0 Left 992029718 5:72709195-72709217 CCAGCCTCCCTCCCTGAGCTCAC No data
Right 992029727 5:72709218-72709240 TGGTGCCCAAAGTTTCAGAGGGG No data
992029720_992029727 -4 Left 992029720 5:72709199-72709221 CCTCCCTCCCTGAGCTCACTGGT No data
Right 992029727 5:72709218-72709240 TGGTGCCCAAAGTTTCAGAGGGG No data
992029717_992029727 1 Left 992029717 5:72709194-72709216 CCCAGCCTCCCTCCCTGAGCTCA No data
Right 992029727 5:72709218-72709240 TGGTGCCCAAAGTTTCAGAGGGG No data
992029713_992029727 13 Left 992029713 5:72709182-72709204 CCCTCAGCAGCCCCCAGCCTCCC No data
Right 992029727 5:72709218-72709240 TGGTGCCCAAAGTTTCAGAGGGG No data
992029722_992029727 -8 Left 992029722 5:72709203-72709225 CCTCCCTGAGCTCACTGGTGCCC No data
Right 992029727 5:72709218-72709240 TGGTGCCCAAAGTTTCAGAGGGG No data
992029714_992029727 12 Left 992029714 5:72709183-72709205 CCTCAGCAGCCCCCAGCCTCCCT No data
Right 992029727 5:72709218-72709240 TGGTGCCCAAAGTTTCAGAGGGG No data
992029711_992029727 27 Left 992029711 5:72709168-72709190 CCTGCACCAAACTGCCCTCAGCA No data
Right 992029727 5:72709218-72709240 TGGTGCCCAAAGTTTCAGAGGGG No data
992029721_992029727 -7 Left 992029721 5:72709202-72709224 CCCTCCCTGAGCTCACTGGTGCC No data
Right 992029727 5:72709218-72709240 TGGTGCCCAAAGTTTCAGAGGGG No data
992029716_992029727 2 Left 992029716 5:72709193-72709215 CCCCAGCCTCCCTCCCTGAGCTC No data
Right 992029727 5:72709218-72709240 TGGTGCCCAAAGTTTCAGAGGGG No data
992029712_992029727 21 Left 992029712 5:72709174-72709196 CCAAACTGCCCTCAGCAGCCCCC No data
Right 992029727 5:72709218-72709240 TGGTGCCCAAAGTTTCAGAGGGG No data
992029715_992029727 3 Left 992029715 5:72709192-72709214 CCCCCAGCCTCCCTCCCTGAGCT No data
Right 992029727 5:72709218-72709240 TGGTGCCCAAAGTTTCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992029727 Original CRISPR TGGTGCCCAAAGTTTCAGAG GGG Intergenic
No off target data available for this crispr