ID: 992030207

View in Genome Browser
Species Human (GRCh38)
Location 5:72713513-72713535
Sequence TTGAACAAAAAGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992030201_992030207 -2 Left 992030201 5:72713492-72713514 CCAATCTGTTGAGGGCCCAAATT No data
Right 992030207 5:72713513-72713535 TTGAACAAAAAGGAGGAGGAAGG No data
992030195_992030207 24 Left 992030195 5:72713466-72713488 CCCTCACCAATGCATGTAGGCAC No data
Right 992030207 5:72713513-72713535 TTGAACAAAAAGGAGGAGGAAGG No data
992030197_992030207 18 Left 992030197 5:72713472-72713494 CCAATGCATGTAGGCACCATCCA No data
Right 992030207 5:72713513-72713535 TTGAACAAAAAGGAGGAGGAAGG No data
992030200_992030207 2 Left 992030200 5:72713488-72713510 CCATCCAATCTGTTGAGGGCCCA No data
Right 992030207 5:72713513-72713535 TTGAACAAAAAGGAGGAGGAAGG No data
992030193_992030207 27 Left 992030193 5:72713463-72713485 CCACCCTCACCAATGCATGTAGG No data
Right 992030207 5:72713513-72713535 TTGAACAAAAAGGAGGAGGAAGG No data
992030196_992030207 23 Left 992030196 5:72713467-72713489 CCTCACCAATGCATGTAGGCACC No data
Right 992030207 5:72713513-72713535 TTGAACAAAAAGGAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992030207 Original CRISPR TTGAACAAAAAGGAGGAGGA AGG Intergenic
No off target data available for this crispr