ID: 992030388

View in Genome Browser
Species Human (GRCh38)
Location 5:72715287-72715309
Sequence CCTCATCAGCAATGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992030388_992030394 27 Left 992030388 5:72715287-72715309 CCTTCCTCACATTGCTGATGAGG No data
Right 992030394 5:72715337-72715359 CAAGGTGTAATATATGAAATAGG No data
992030388_992030393 9 Left 992030388 5:72715287-72715309 CCTTCCTCACATTGCTGATGAGG No data
Right 992030393 5:72715319-72715341 AAACAATGAAGCATTTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992030388 Original CRISPR CCTCATCAGCAATGTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr