ID: 992032288

View in Genome Browser
Species Human (GRCh38)
Location 5:72733764-72733786
Sequence GAGCACTCCCACCTATTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992032285_992032288 22 Left 992032285 5:72733719-72733741 CCCTAGAACTTAGAGTATAATAA No data
Right 992032288 5:72733764-72733786 GAGCACTCCCACCTATTCTTGGG No data
992032286_992032288 21 Left 992032286 5:72733720-72733742 CCTAGAACTTAGAGTATAATAAT No data
Right 992032288 5:72733764-72733786 GAGCACTCCCACCTATTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992032288 Original CRISPR GAGCACTCCCACCTATTCTT GGG Intergenic