ID: 992034162

View in Genome Browser
Species Human (GRCh38)
Location 5:72754912-72754934
Sequence CTGTGGTGAAGAGCTCTACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992034162_992034165 7 Left 992034162 5:72754912-72754934 CCACGTAGAGCTCTTCACCACAG No data
Right 992034165 5:72754942-72754964 GGCAAAGCCATAAAAACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992034162 Original CRISPR CTGTGGTGAAGAGCTCTACG TGG (reversed) Intergenic
No off target data available for this crispr