ID: 992035491

View in Genome Browser
Species Human (GRCh38)
Location 5:72770643-72770665
Sequence TTGAACAAGCACCAGTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992035491_992035495 30 Left 992035491 5:72770643-72770665 CCCTCCTACTGGTGCTTGTTCAA No data
Right 992035495 5:72770696-72770718 GTGCAGCTCTTTACCACTGTTGG No data
992035491_992035494 -10 Left 992035491 5:72770643-72770665 CCCTCCTACTGGTGCTTGTTCAA No data
Right 992035494 5:72770656-72770678 GCTTGTTCAATCAAAGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992035491 Original CRISPR TTGAACAAGCACCAGTAGGA GGG (reversed) Intergenic
No off target data available for this crispr