ID: 992035910

View in Genome Browser
Species Human (GRCh38)
Location 5:72775876-72775898
Sequence CTGTGGGACAGGAGAGGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992035910_992035921 24 Left 992035910 5:72775876-72775898 CCTACTCCTCTCCTGTCCCACAG No data
Right 992035921 5:72775923-72775945 CTAAACCACCTGCAGTGAATTGG No data
992035910_992035919 1 Left 992035910 5:72775876-72775898 CCTACTCCTCTCCTGTCCCACAG No data
Right 992035919 5:72775900-72775922 AATCATCAGGAGTTCCAGGAGGG No data
992035910_992035923 26 Left 992035910 5:72775876-72775898 CCTACTCCTCTCCTGTCCCACAG No data
Right 992035923 5:72775925-72775947 AAACCACCTGCAGTGAATTGGGG No data
992035910_992035917 -3 Left 992035910 5:72775876-72775898 CCTACTCCTCTCCTGTCCCACAG No data
Right 992035917 5:72775896-72775918 CAGGAATCATCAGGAGTTCCAGG No data
992035910_992035918 0 Left 992035910 5:72775876-72775898 CCTACTCCTCTCCTGTCCCACAG No data
Right 992035918 5:72775899-72775921 GAATCATCAGGAGTTCCAGGAGG No data
992035910_992035922 25 Left 992035910 5:72775876-72775898 CCTACTCCTCTCCTGTCCCACAG No data
Right 992035922 5:72775924-72775946 TAAACCACCTGCAGTGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992035910 Original CRISPR CTGTGGGACAGGAGAGGAGT AGG (reversed) Intergenic
No off target data available for this crispr