ID: 992037814

View in Genome Browser
Species Human (GRCh38)
Location 5:72798301-72798323
Sequence GAAAAGGCAGAGATGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992037807_992037814 15 Left 992037807 5:72798263-72798285 CCATAAAGCTCGAGAAGGGCTCA No data
Right 992037814 5:72798301-72798323 GAAAAGGCAGAGATGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992037814 Original CRISPR GAAAAGGCAGAGATGCAGGG TGG Intergenic
No off target data available for this crispr