ID: 992038922

View in Genome Browser
Species Human (GRCh38)
Location 5:72809142-72809164
Sequence TCTCTACTCCACCAGGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992038922_992038927 -5 Left 992038922 5:72809142-72809164 CCAGGGCCCTGGTGGAGTAGAGA No data
Right 992038927 5:72809160-72809182 AGAGACCCAAGGGAATCTCCTGG No data
992038922_992038932 18 Left 992038922 5:72809142-72809164 CCAGGGCCCTGGTGGAGTAGAGA No data
Right 992038932 5:72809183-72809205 TCTGCAGGTTGCAAAGACTGTGG 0: 15
1: 46
2: 217
3: 396
4: 849
992038922_992038930 3 Left 992038922 5:72809142-72809164 CCAGGGCCCTGGTGGAGTAGAGA No data
Right 992038930 5:72809168-72809190 AAGGGAATCTCCTGGTCTGCAGG 0: 74
1: 418
2: 626
3: 555
4: 518
992038922_992038933 19 Left 992038922 5:72809142-72809164 CCAGGGCCCTGGTGGAGTAGAGA No data
Right 992038933 5:72809184-72809206 CTGCAGGTTGCAAAGACTGTGGG 0: 13
1: 46
2: 214
3: 388
4: 961

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992038922 Original CRISPR TCTCTACTCCACCAGGGCCC TGG (reversed) Intergenic
No off target data available for this crispr