ID: 992041427

View in Genome Browser
Species Human (GRCh38)
Location 5:72837072-72837094
Sequence TGCAATTGGGTAATGGGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 967
Summary {0: 1, 1: 3, 2: 14, 3: 182, 4: 767}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992041427_992041432 -1 Left 992041427 5:72837072-72837094 CCTTTACCCATTACCCAATTGCA 0: 1
1: 3
2: 14
3: 182
4: 767
Right 992041432 5:72837094-72837116 AAAGCCACTTCCACATTTTTAGG 0: 41
1: 431
2: 1262
3: 1856
4: 2231
992041427_992041435 29 Left 992041427 5:72837072-72837094 CCTTTACCCATTACCCAATTGCA 0: 1
1: 3
2: 14
3: 182
4: 767
Right 992041435 5:72837124-72837146 TATAGTAGCACCCCACTTCTTGG 0: 1
1: 1
2: 14
3: 74
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992041427 Original CRISPR TGCAATTGGGTAATGGGTAA AGG (reversed) Intronic
900628315 1:3619839-3619861 TGGAACTGGGTAATGGGCAGAGG + Intergenic
901886712 1:12228772-12228794 TACAACAGGGTAATGGATAATGG + Intergenic
902967145 1:20013770-20013792 TGAAATGGGGTACTGGGTAGAGG - Intergenic
903394194 1:22986792-22986814 TGGAACTGGGTCATGGGTAGAGG + Intergenic
903591409 1:24458650-24458672 TTCAATTGGGAAATGGGGATGGG + Intronic
903996943 1:27311974-27311996 TACAATAAGGGAATGGGTAAGGG - Intergenic
904062652 1:27723955-27723977 GGAAATTGTTTAATGGGTAAGGG - Intergenic
904861953 1:33545078-33545100 TGGAATTGGGAAGTGTGTAATGG - Intronic
905095181 1:35464167-35464189 TGCAACTGGGTAACAGGTAGAGG + Intronic
905713845 1:40131308-40131330 TCCCATTGGGGAATGGGTCAGGG - Intergenic
905966037 1:42096482-42096504 TGGAATTGGGTAATGGGCAGAGG - Intergenic
906017470 1:42594809-42594831 TGCATTTTGCTAATGGGTATTGG + Intronic
906371473 1:45257596-45257618 TGGAATTGGGTAATGGGCAGAGG + Intronic
906991639 1:50745854-50745876 TGAAACTGGGTAATGGGCAGAGG + Intronic
906995261 1:50786635-50786657 TGCAAATGGGTACAGGGTGAAGG + Intronic
907292035 1:53421528-53421550 TGGAAGTGAATAATGGGTAAAGG + Intergenic
907587116 1:55629907-55629929 TGGAACTGGGTAATGGGTAGTGG - Intergenic
907598892 1:55746834-55746856 TGGAACTAGGTAATGGGTAAAGG - Intergenic
907627160 1:56041492-56041514 TGTAACTGGGTAATGGGTAGAGG - Intergenic
907749061 1:57244977-57244999 TGGAACTGGGTAAGGGGTAGAGG + Intronic
908032809 1:60019523-60019545 TGGAACTGGGTAATGGGTAAAGG + Intronic
908062899 1:60371205-60371227 TGCAATTGGGTAATGGGCAGAGG + Intergenic
908380923 1:63595876-63595898 AGCAATAGGGCAATGGCTAAAGG - Intronic
908468870 1:64422602-64422624 TGAAACTGGGTAATAGGTAGAGG - Intergenic
908600767 1:65737444-65737466 TGGAATGGGGTAATGGGTAGAGG + Intergenic
908720366 1:67119038-67119060 TGGAATTTGTTAATGGGTAGAGG + Intronic
908900566 1:68951625-68951647 TGAAATTGTGTAATGGGTAGAGG + Intergenic
909206240 1:72761322-72761344 TGAAACTGGCTAATGGGTAAAGG - Intergenic
909468682 1:76002542-76002564 TGAAATTGGGTAATAGGCCAAGG - Intergenic
909527776 1:76645948-76645970 TGGAACTGGATAATGGGTAGAGG - Intergenic
909729078 1:78872037-78872059 TGGAACTGGGTAATGGGCAGAGG - Intergenic
909741585 1:79036369-79036391 TGAAACTGGGTAATGGGCAGAGG + Intergenic
909792257 1:79694179-79694201 TGGAACTGGGTAATGGGGAGAGG - Intergenic
909832034 1:80203740-80203762 TGAAATTGGGTAATGAGCAGAGG - Intergenic
910010192 1:82452235-82452257 TGGAACTGGATAATGGATAAAGG - Intergenic
910424111 1:87101730-87101752 TGGAACTGGGTAATGGGCAGCGG - Intronic
910729505 1:90377822-90377844 TGGGATTGGGCAATGGGTAGAGG - Intergenic
910831878 1:91469609-91469631 TGGAATTGAGTAATGGGCAGAGG + Intergenic
911009454 1:93263720-93263742 TGGAACTGGGTAATGGGCAGAGG - Intronic
911228465 1:95333903-95333925 TGAAACTGGGTAAAGGGTAGAGG - Intergenic
911392976 1:97269413-97269435 TGGAACTGGGTAACGGGTAGAGG - Intronic
911497435 1:98648913-98648935 TGGAACTGGGTAATGGGTATAGG - Intergenic
911596308 1:99802221-99802243 TGGAAATGGGTAATGGGTAGAGG - Intergenic
911643983 1:100319479-100319501 TGAAACTGGATAATGGGTAGAGG + Intergenic
911695969 1:100890843-100890865 TGGAACTGGGTAATGGGTAGAGG - Intronic
911802985 1:102167554-102167576 TGGAACTGAGTAATGGGTAGAGG + Intergenic
912042973 1:105415911-105415933 TGGAATTGGGTAATAGGCAGAGG + Intergenic
912070394 1:105801853-105801875 TGCAGTTGGGTAACAGGTAGAGG - Intergenic
912083930 1:105976172-105976194 TGGAACTGGGTAACAGGTAAAGG + Intergenic
912223302 1:107701965-107701987 TGGAACTGGGTAATGGATAGAGG - Intronic
912278864 1:108291416-108291438 TGGAAGTGGGTAATGGGTAGAGG - Intergenic
912289362 1:108402941-108402963 TGGAAGTGGGTAATGGGTAGAGG + Intronic
912581865 1:110728255-110728277 TGTAATGGTGTAATGGGTAAAGG + Intergenic
912774774 1:112498892-112498914 TGAAATTGGGTAATGGATAGAGG - Intronic
912861239 1:113215828-113215850 TGGAACTGGGTAATGGACAAAGG - Intergenic
912895986 1:113589552-113589574 GGCAATGGGGAAATGGGTAGAGG + Intronic
913352242 1:117874636-117874658 TGGAACTGGGTAATGGGCAGAGG + Intronic
913549321 1:119902111-119902133 TGGAACTGGGTAATGAGTAGAGG + Intergenic
914453974 1:147818185-147818207 TGGAACTGAGTAATGGGTAGAGG - Intergenic
914988192 1:152477457-152477479 TGGAATTGGGTAATAGGCAGAGG - Intergenic
915978235 1:160404538-160404560 GACAATTGTGTAATGGGTATGGG - Intronic
916397828 1:164411424-164411446 TGGAACTGGATAATGGGCAAAGG + Intergenic
916847598 1:168669048-168669070 TGGAACTGGGTAATGGGTAGAGG + Intergenic
916982439 1:170153342-170153364 TGGAACTGGGTAATGGGAAGAGG + Intronic
917246910 1:173013307-173013329 TGGAACTGAGTAATGGGTGAAGG + Intergenic
917408880 1:174737564-174737586 TGGAATTGGGTAACAGGTAGAGG - Intronic
917418801 1:174840259-174840281 TGCAGTTGGATAATTTGTAAGGG - Intronic
917578162 1:176345820-176345842 TGGAACTGGGTAATGGGCAAAGG - Intergenic
917694413 1:177507027-177507049 GGCAATTGGGCAATGGGCAGAGG - Intergenic
917698611 1:177556325-177556347 TGGAATGGAGTAATGGGTAGAGG - Intergenic
918712399 1:187747848-187747870 TGGAACTGGGTAATGGGTAAAGG + Intergenic
918781459 1:188705018-188705040 TGGAATAGGATAATGGGTAGAGG - Intergenic
918863042 1:189858404-189858426 TGAGATTGGGTAATCTGTAAAGG + Intergenic
918969566 1:191397021-191397043 TGGAACTGGGTAATAGGTAGAGG + Intergenic
919349477 1:196431313-196431335 TGGAATTGGGTAATGGGTAGAGG + Intronic
919366533 1:196668908-196668930 TGGAACTGGGTAATGGGCAGAGG + Intronic
920196564 1:204231172-204231194 TGTAATTGGCTAACGGGTAGAGG + Intronic
920819196 1:209364608-209364630 TGGGATTTGGGAATGGGTAAGGG + Intergenic
921386239 1:214572631-214572653 TGAAATTAGGTAATGGGGATAGG - Intergenic
921465192 1:215478449-215478471 TGGAACTGGGTAATGGGCAGAGG - Intergenic
921755765 1:218854380-218854402 TGGAACTGGGTAATAGGTAGAGG + Intergenic
922069270 1:222174924-222174946 TGGAACTGGATAATGGGCAAAGG - Intergenic
923891040 1:238215134-238215156 TGGAACTGGGTAATGGGCAAAGG - Intergenic
924936870 1:248779246-248779268 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1063780284 10:9315005-9315027 TGAAACTGGGTAATTTGTAAAGG + Intergenic
1063917366 10:10897013-10897035 TGGAATTGGGTAATGGGTAAAGG + Intergenic
1064358644 10:14642978-14643000 TGGAATTGGGTAATGGGTAGAGG - Intronic
1064904357 10:20329723-20329745 TGGAAGTGGGTAATAGGTACAGG + Intergenic
1065921259 10:30394887-30394909 TGAGACTGGGTAATGTGTAAAGG - Intergenic
1066996526 10:42569344-42569366 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1067016901 10:42763973-42763995 TGGAAGTGGGTAATGGGCAGAGG - Intergenic
1067537344 10:47123114-47123136 TGGAACTGGGTAATGGGTAGAGG + Intergenic
1068180464 10:53511886-53511908 TGGAAATGGGTAATGGGTGAAGG + Intergenic
1068386215 10:56331099-56331121 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1068449434 10:57166450-57166472 TGGAACTGGGTAATGAGTAGAGG - Intergenic
1068902643 10:62287233-62287255 TGCAACTGGGTAATGAATAGAGG - Intergenic
1069380743 10:67841274-67841296 TGAAACTGGGTAATGGGCAGAGG + Intergenic
1069730299 10:70607282-70607304 TGCAGCTGAGTAATGGGTAGAGG + Intergenic
1070581516 10:77723913-77723935 TGCAATTGGGTAATGAGCAGAGG + Intergenic
1071163898 10:82782591-82782613 TGGAGTTGGGTAATGGCTACGGG + Intronic
1071981135 10:91005191-91005213 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1072058283 10:91782704-91782726 TGGAACTGGGTAGTGGGTAGAGG - Intergenic
1072395112 10:95031565-95031587 TGCAAATGGGGAGTGGGTTAAGG - Intergenic
1073743495 10:106439347-106439369 TGAAAGTAGGTAATGGGTATTGG - Intergenic
1073806790 10:107107130-107107152 TGAAACTGGGCAATGGGTAGAGG + Intronic
1073880204 10:107972606-107972628 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1074018508 10:109560417-109560439 TGGAACTGGGTAATGGGTGGAGG - Intergenic
1074197884 10:111205336-111205358 TACAATTGGGTACCTGGTAAAGG - Intergenic
1074670599 10:115786194-115786216 TGGAATTGGGTAATGGGTGGAGG - Intronic
1074670602 10:115786201-115786223 TGGAATTTGGAATTGGGTAATGG - Intronic
1076086320 10:127635293-127635315 TGCAACTGGGTAATGGGCAGAGG - Intergenic
1077736931 11:4801191-4801213 TGGAACTGGGTAATGGGCAGAGG - Intronic
1077993223 11:7431003-7431025 TGGAATTGGGTAATGGACAAAGG + Intronic
1078588796 11:12619778-12619800 TGCATTTGGGAAATGTGGAAAGG - Intergenic
1078686488 11:13537020-13537042 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1078750305 11:14155182-14155204 TGGAACTGGGTAATGGGCAGAGG - Intronic
1079819442 11:25106487-25106509 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1079873612 11:25830492-25830514 GGCAACTGGGTAATAGGTAGAGG - Intergenic
1079952772 11:26824786-26824808 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1080017290 11:27520956-27520978 TGGAAGTGGGAAATGGGCAATGG - Intergenic
1080128428 11:28765559-28765581 TGGAACTGGGTAGTGGGTAGAGG + Intergenic
1080131716 11:28803201-28803223 TGGAATTGAATAATGGGTAGAGG - Intergenic
1080437919 11:32263256-32263278 TGGAACTGGATAATGGGTAGAGG - Intergenic
1080739220 11:35048342-35048364 TGGAACTGGGTAACAGGTAAAGG + Intergenic
1080946517 11:36980475-36980497 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1080961835 11:37169579-37169601 TGGAATTGGGTTATGGGTAAAGG - Intergenic
1081016900 11:37892994-37893016 TGGAACTGGGTAATGGGCAAAGG - Intergenic
1081068464 11:38577919-38577941 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1081188911 11:40079687-40079709 TGGAATTGGGTAATGGGCAGAGG + Intergenic
1081429703 11:42963009-42963031 TGGAATTGTGTAATGGGTAGAGG - Intergenic
1081441578 11:43086692-43086714 TGGAACTGGGTAATGGGAAGAGG - Intergenic
1081628907 11:44674055-44674077 TGAAACTGGGTAATTTGTAAAGG - Intergenic
1081766035 11:45610745-45610767 TGCAGTGGGGAAATGGGTGAGGG - Intergenic
1082930788 11:58602800-58602822 TGGGATTGGGTAATGGATATTGG + Intronic
1083102803 11:60327548-60327570 TGGAACTGGGTAATGGGTAGAGG + Intergenic
1083177612 11:60961207-60961229 TCCAATTGGGCAATGGGTTCTGG + Intergenic
1083457601 11:62789418-62789440 TACAATTAGGTAATGGGAGAGGG + Exonic
1084200105 11:67551101-67551123 TGGAATTGGGTAATGGGCAGAGG + Intergenic
1084323495 11:68386280-68386302 TGCAATGGGGTCAGGGGTCAAGG - Intronic
1085875904 11:80405681-80405703 TGCAACTGAGTAATTTGTAAAGG - Intergenic
1085883851 11:80499358-80499380 TGAAACTGGATAATGGGTAAAGG + Intergenic
1085885534 11:80517579-80517601 TGGAATTGGGTAATGGGCAGAGG + Intergenic
1086131298 11:83405195-83405217 TGAAATTGGGTAATTTATAAAGG - Intergenic
1086541100 11:87914074-87914096 TCAAATTGGGTAATGAGCAAAGG + Intergenic
1086821677 11:91443352-91443374 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1086860465 11:91919413-91919435 TGGAACTGGGTAATGGGTAGGGG - Intergenic
1086995846 11:93354422-93354444 TGGAACTGGGTAATGGGCAGAGG - Intronic
1087205753 11:95392131-95392153 TGGAACTGGGTAATGGATAATGG - Intergenic
1087446928 11:98267800-98267822 TGCAACTGGGTAATTTATAAAGG + Intergenic
1087612136 11:100447369-100447391 TGGAACTGGGTAATGGGTAGAGG + Intergenic
1087877376 11:103374477-103374499 TGAAACTGGGTAATGGGCAGAGG + Intronic
1088850738 11:113701208-113701230 TGGAATTGGGTAACAGGTAGAGG + Intronic
1089540202 11:119185366-119185388 AGCAGTGGGGTAATGGTTAACGG - Intergenic
1089766494 11:120771061-120771083 TGGAACTGGGTAATGGGTAGAGG + Intronic
1089878090 11:121745387-121745409 TATAACTGGGTAATGGGTAGAGG + Intergenic
1090544504 11:127748061-127748083 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1090595446 11:128315870-128315892 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1090704919 11:129327616-129327638 TGGGATTGGGGAATGGGCAATGG - Intergenic
1091125312 11:133090299-133090321 TGGAACTGGGTAATGGGCAGAGG + Intronic
1092919623 12:13219478-13219500 TGGAACTGGGTAACGGGTAGAGG - Exonic
1093280719 12:17193211-17193233 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1093960339 12:25265689-25265711 TGGAACTGGGTAATGGGTAGAGG - Intergenic
1094090401 12:26643366-26643388 TGAAACTGGGTAGTGGGTAGAGG + Intronic
1094743421 12:33315395-33315417 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1095873111 12:47051915-47051937 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1095978535 12:47956643-47956665 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1097343761 12:58468344-58468366 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1097571360 12:61335961-61335983 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1097788129 12:63783666-63783688 TGAAATTGGGTAATGGGGAAAGG - Intronic
1098319739 12:69231334-69231356 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1098433391 12:70444575-70444597 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1098774797 12:74599497-74599519 TGGAATTGGGTAATGGACAGAGG + Intergenic
1099907642 12:88791052-88791074 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1100152696 12:91759966-91759988 TGGAATTGAGCAATGGGTAGAGG + Intergenic
1100170696 12:91971586-91971608 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1100230425 12:92601129-92601151 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1100823830 12:98456719-98456741 TGCAATTGAGTAATTTGTCACGG + Intergenic
1101190981 12:102332164-102332186 TGGAATTGGGTAATGAATAGAGG + Intergenic
1105657585 13:22457488-22457510 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1106130437 13:26934981-26935003 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1106960422 13:34991173-34991195 TGTAACTGGGTAATGGGCAGAGG - Intronic
1107146232 13:37063273-37063295 TGGAACTAGGTAATGGGTAGAGG - Intergenic
1107267947 13:38579706-38579728 TGCAACTGGGTAATTTATAAAGG - Intergenic
1107330608 13:39295854-39295876 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1107972393 13:45655866-45655888 TGGAACTGGGTAATGGGTAGAGG - Intergenic
1108602334 13:52005712-52005734 TGGAACTGGGTAAAGGGTAGAGG - Intronic
1108768292 13:53662709-53662731 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1108770873 13:53699236-53699258 TGGAACTGGGTAATGGGAAGAGG + Intergenic
1108792978 13:53995273-53995295 TGTAACTTGGTAATGGGTAGAGG + Intergenic
1108873605 13:55017759-55017781 TGGAACTGAGTAATGGGTAGAGG + Intergenic
1108883880 13:55155886-55155908 TGGAACTGGGTAATGGACAAAGG + Intergenic
1108951515 13:56100108-56100130 TGGACCTGGGTAATGGGTACAGG - Intergenic
1109344572 13:61099358-61099380 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1109485340 13:63010927-63010949 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1109823995 13:67693171-67693193 TGGAATTGGGTAATAGGCAGAGG - Intergenic
1109906160 13:68845196-68845218 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1109961981 13:69643631-69643653 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1110893025 13:80713747-80713769 TGGAACTGGGTAATGGGAAAAGG - Intergenic
1110955821 13:81550973-81550995 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1111102418 13:83605507-83605529 TGCAACTGGGTAACGGGCAGAGG + Intergenic
1111103116 13:83612546-83612568 TGGAACTGGGTAACAGGTAAAGG - Intergenic
1111182360 13:84685788-84685810 TGGAATTGGGTAATGGGTAAAGG + Intergenic
1111212524 13:85098103-85098125 TGAAACTGGGTAATGTATAAAGG - Intergenic
1111221231 13:85207732-85207754 TGGAATTGGGTAATGAGCAGAGG + Intergenic
1111271384 13:85891843-85891865 TGGAATTGGGTAATGGGCAGAGG + Intergenic
1111325918 13:86695698-86695720 TGGAATTGGGTAATAGGCAGCGG - Intergenic
1111360333 13:87167593-87167615 TGGAACTGGGTAATGGGTAGAGG + Intergenic
1111458134 13:88509779-88509801 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1111664481 13:91249731-91249753 TGAAATTGGGGAGGGGGTAATGG + Intergenic
1111788186 13:92817964-92817986 TCCACCTGGGTAATGGGTAATGG + Intronic
1112055167 13:95684068-95684090 TGGAATGGGGTAATGGGCAGAGG + Intronic
1112512091 13:100019142-100019164 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1112743060 13:102496413-102496435 TGTAACTGGGTAATGGGCAGAGG - Intergenic
1112826406 13:103397497-103397519 TGGAACTGGGTAATGGGTAGAGG - Intergenic
1112906537 13:104429465-104429487 TGGAACTGGGTAATGGGTACAGG - Intergenic
1113976626 13:114232205-114232227 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1114068339 14:19086118-19086140 TGGAAGTGGGTAATGGGCAGAGG + Intergenic
1114093926 14:19313907-19313929 TGGAAGTGGGTAATGGGCAGAGG - Intergenic
1114574568 14:23700352-23700374 TGGAACTGGGTAATGGGTAGAGG + Intergenic
1114778518 14:25513740-25513762 TGAAAATGGGTAATGTATAAAGG + Intergenic
1115065784 14:29257887-29257909 TGGAAATGGGTAATGGGCAGAGG - Intergenic
1115106692 14:29770307-29770329 TAGAAATGGGTAATGAGTAAAGG + Intronic
1115140901 14:30169746-30169768 AGCAACTGGGTAATGGGCAGAGG - Intronic
1115525112 14:34272157-34272179 TGGAACTGGATGATGGGTAAAGG - Intronic
1115821973 14:37222832-37222854 TGGAACTAGGTAATGGGTAGAGG - Intronic
1116091016 14:40307197-40307219 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1116287067 14:42987180-42987202 TGCAACGGGGTAATAGGTAGAGG + Intergenic
1116387300 14:44347548-44347570 TGGAATTGGGTAATAGGCAGAGG + Intergenic
1116439943 14:44939858-44939880 TGGAACTGGTTAATGGGTAGAGG - Intronic
1116526928 14:45917118-45917140 TGGAATTGGGTAATGGGGAGAGG - Intergenic
1116527005 14:45917698-45917720 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1116739406 14:48735369-48735391 TGGAACTGGGTAATGGGTGGAGG - Intergenic
1116784009 14:49268009-49268031 TGAAACTGGGTAATTTGTAAAGG - Intergenic
1117209730 14:53483040-53483062 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1117632407 14:57707685-57707707 TGGAACTGGGTAATGGGCAGAGG + Intronic
1118053360 14:62053012-62053034 TGGAACCGGGTAATGGGTAGAGG + Intronic
1118067535 14:62208087-62208109 TGAAACTGGGTAATGAGTAGAGG - Intergenic
1118105920 14:62659452-62659474 TGAAACTGGGTCATGGGTAGAGG + Intergenic
1118120089 14:62830283-62830305 TGGAAGTGGGTAATGGGCAGAGG - Intronic
1118700224 14:68425746-68425768 TGGTATTGGGTGATGGGTAAAGG + Intronic
1118957095 14:70492217-70492239 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1119252335 14:73167618-73167640 TGGAATAGGGTAAGGGATAAAGG - Intronic
1119547614 14:75483796-75483818 TGGAACTGGGTAAGGGGTAGAGG - Intergenic
1119862544 14:77947001-77947023 TGGAACTGGGTGATGGGTAGAGG + Intergenic
1119875979 14:78059795-78059817 GACAGTTGGGCAATGGGTAATGG - Intergenic
1120225765 14:81789547-81789569 TGAAACTGGGTAATGGGCAGAGG + Intergenic
1120231943 14:81849689-81849711 TGAGATTGGGTAATGGGCAGAGG - Intergenic
1120377732 14:83730726-83730748 TGGAATAGGGTAATGGGCAGAGG - Intergenic
1120515374 14:85464149-85464171 TGGAACTGGGTAATGGGCAGGGG + Intergenic
1120696265 14:87648979-87649001 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1121128675 14:91426047-91426069 TGGAACTGGGTAATAGGTAGAGG + Intergenic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1121384867 14:93510822-93510844 TGGAACTGGGTAACGGGCAAAGG - Intronic
1121738295 14:96234151-96234173 TCCAATTGGGTAATAGGAAGAGG + Intronic
1122380041 14:101296462-101296484 TGGAACTGGGTAACGGGCAAAGG - Intergenic
1123099578 14:105787485-105787507 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1123140439 14:106072409-106072431 TGTAACTGGGTAATGGGCAGAGG + Intergenic
1202837516 14_GL000009v2_random:89506-89528 CGGAACTGGGTAATGGGTAGAGG + Intergenic
1202906899 14_GL000194v1_random:79636-79658 CGGAACTGGGTAATGGGTAGAGG + Intergenic
1123721122 15:23062811-23062833 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1123875359 15:24618467-24618489 TGGAACTGGGTAATGGGCAAAGG - Intergenic
1123904515 15:24908312-24908334 TGGAACTGAGTAATGGGTAGAGG + Intronic
1124230757 15:27944365-27944387 TGCAATTGAGTTTTGGGGAAGGG - Intronic
1124444866 15:29721636-29721658 TGGAACTGGGTAATGGGCAGAGG + Intronic
1124705343 15:31959333-31959355 TGAAACTGGGTAATAGGTAGAGG + Intergenic
1125066201 15:35488244-35488266 TGGAACTGGGTAATGGGCAGAGG - Intronic
1125225468 15:37390481-37390503 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1125407906 15:39372114-39372136 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1126261412 15:46697050-46697072 AGCAATAGGGCAGTGGGTAAGGG + Intergenic
1126929412 15:53631511-53631533 TGGAATTGGGTAATGGGCAGAGG + Intronic
1127186573 15:56486497-56486519 TGCAACTGGGTAATTTATAAAGG - Intergenic
1129057389 15:72830667-72830689 TGGAATTGGGTGATGGGTAGAGG - Intergenic
1129073740 15:72973716-72973738 TGGAGTTGGGTGATGGGTAAAGG - Intergenic
1129130445 15:73488857-73488879 TGAAACTGGGTAATGGGTACAGG - Intronic
1129271917 15:74423460-74423482 AGCAGCTGGGTAATGGGTACTGG - Intronic
1129549115 15:76429343-76429365 TGGAACTGGGTAACAGGTAAAGG + Intronic
1129715277 15:77844621-77844643 TGAAACTGGGTAATGGGCAGAGG + Intergenic
1130414589 15:83680368-83680390 TGTATTTGGGTGATGGGCAAGGG + Intronic
1130422130 15:83758077-83758099 TGGAACTGGGTAATGGGCAGAGG - Intronic
1130702338 15:86197162-86197184 TGGAACTGGGTAATGGGTGGAGG + Intronic
1130966823 15:88703945-88703967 TACAAATGTGTAATGGGCAAAGG - Intergenic
1131298071 15:91169731-91169753 TGAAATAGGGTAATGGGTAGCGG + Intronic
1131426939 15:92353475-92353497 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1132121835 15:99183011-99183033 TGGAACTGGGTAATGGGCAGAGG + Intronic
1132260942 15:100424341-100424363 TGAAACTGGGTAATGGGAAGAGG + Intronic
1133783122 16:8954447-8954469 TGCATTCGGGTCATGGGCAATGG + Intronic
1134283334 16:12837529-12837551 TGAAATTGGCTAGTGGGTAGAGG + Intergenic
1135198433 16:20414711-20414733 TGGAATTAGGTGATGGGTAGAGG + Intronic
1135254259 16:20928103-20928125 TGGAACTGGGTAATGGGTAGAGG - Intergenic
1135763060 16:25153159-25153181 TGGAACTGGGTAATGGGTAGAGG - Intronic
1135805175 16:25536129-25536151 TGGAACTGGGTAATGGGTAGAGG + Intergenic
1137358762 16:47792884-47792906 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1138317450 16:56082425-56082447 TGGAACTGGATAATGGGTACAGG - Intergenic
1138603903 16:58074935-58074957 TGGAATTGGATAATGGGTAGAGG + Intergenic
1138730248 16:59186180-59186202 TGGAACTGGGTAATGGGTAGAGG - Intergenic
1138994896 16:62438612-62438634 TCCAAATGGGAAATGGGAAATGG + Intergenic
1140136002 16:72206056-72206078 TGCTATTGGGAAATGGGCCAGGG + Intergenic
1140302768 16:73774219-73774241 TTCATTTTTGTAATGGGTAAGGG + Intergenic
1140588231 16:76320011-76320033 TGGAATTGAGTAATGAGCAAAGG + Intronic
1141109018 16:81256934-81256956 TGAAATTGGGAAATGGGTTGAGG - Intronic
1142938832 17:3363600-3363622 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1143271310 17:5677208-5677230 TGGAATAGGGTAATGTGGAAAGG + Intergenic
1144257142 17:13480205-13480227 TGGAACTGCGTAATGGGTAGAGG + Intergenic
1144351545 17:14401907-14401929 TGGAACTGAGTAATGGGTAGAGG + Intergenic
1144605282 17:16659226-16659248 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1144752005 17:17655338-17655360 TGGAACTGGGTAATGGCTAGAGG - Intergenic
1144938076 17:18916244-18916266 TGGAACTGGGTAATGGGCAGAGG - Intronic
1145341991 17:21962848-21962870 TGCAATGGATTAGTGGGTAATGG + Intergenic
1146158732 17:30547447-30547469 TGCAAGTGGATAATGAGTAGAGG + Intergenic
1146476690 17:33168318-33168340 TGGAACTGAGTAATGGGTAGAGG + Intronic
1147247181 17:39130118-39130140 AGCAACTGCTTAATGGGTAAAGG + Intronic
1148762695 17:50015502-50015524 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1149363325 17:55916065-55916087 TGAAATTGGGTAATTTATAAAGG - Intergenic
1150350366 17:64439645-64439667 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1150751035 17:67862955-67862977 TGGAACTGGGTAATGGGAAGAGG - Intronic
1150889780 17:69134502-69134524 TGAGATTGGGTAATTTGTAAAGG - Intronic
1151204637 17:72497250-72497272 TGTGATTGGGTAATTTGTAAAGG + Intergenic
1151366576 17:73620869-73620891 AGCAACTGCTTAATGGGTAAGGG + Intronic
1151435557 17:74094160-74094182 TGGAACTGGGTAATGAGTAGAGG - Intergenic
1153000456 18:450716-450738 TGGAACTGGGTAATGGGCAGAGG + Intronic
1153134564 18:1899897-1899919 TCCAGTTGGGTGATGTGTAAGGG + Intergenic
1153690814 18:7591878-7591900 TGCAATTGAGAAGTGGGGAAGGG + Intronic
1153769483 18:8403719-8403741 TGGAAGTGGGTAATGGGGAGTGG - Intronic
1153843949 18:9031859-9031881 TGGATCTGGGTAATGGGTAGAGG + Intergenic
1156070394 18:33200222-33200244 TGCACTGGGGTAATGGGACAAGG + Intronic
1156182377 18:34620514-34620536 TGAGATTGGGTAATGTATAAAGG + Intronic
1156250904 18:35351830-35351852 TGGAACTGGGTAATGGGAAGAGG + Intergenic
1156386283 18:36608072-36608094 TGGAATTGGGTAACAGGTAGAGG - Intronic
1156914468 18:42448765-42448787 TGGAACTGGGTAATGGGTAGAGG - Intergenic
1157820643 18:50765907-50765929 TGGAATTGGGTAATGGACAGAGG - Intergenic
1159643109 18:70887074-70887096 TGGAACTGGGTAATGGGAAGAGG + Intergenic
1159713750 18:71796266-71796288 TGGAATGTGGTAATGGGTAGAGG + Intergenic
1159791010 18:72778832-72778854 TGGAACTGGGTAATGAGTAGAGG - Intronic
1159892424 18:73965204-73965226 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1161339717 19:3734581-3734603 TGGAACTGGGTAATGGGTAGAGG - Intronic
1163239725 19:16053327-16053349 TGGAACTGGGTAATGGGTAGAGG - Intergenic
1165642225 19:37399466-37399488 TGGAATTGTGTAATGGGCAGAGG - Intergenic
1165770408 19:38376640-38376662 TGCAATGTGGGAATGGGTAGGGG - Intronic
1166041513 19:40205608-40205630 TGAAATTGGATGATGGGTACAGG + Intronic
1167786591 19:51643049-51643071 AACTTTTGGGTAATGGGTAATGG + Exonic
925246711 2:2389991-2390013 TGGAATTGGGTAATGTGCAGAGG - Intergenic
925482091 2:4286323-4286345 TGCTATTGGCCAATGGGCAAAGG + Intergenic
925516725 2:4691374-4691396 TGGAACTGGGTAATGGGCAGAGG - Intergenic
926477918 2:13351067-13351089 TGCAATTATGTAATGACTAATGG - Intergenic
926638121 2:15206010-15206032 TGGAACTGGGTAATGGGTAGAGG + Intronic
926768914 2:16350699-16350721 TGGAACTGGGTAATGGGCAGAGG + Intergenic
927260013 2:21078828-21078850 TGAAACTGGGCAATGGGTAATGG + Intergenic
928609824 2:32982021-32982043 TGGAATTGGGTAACAGGCAAAGG + Intronic
928808995 2:35198817-35198839 TGCAATGGGGGTATGGGCAATGG - Intergenic
928821937 2:35372076-35372098 TGGAACTGGGTAATGGGCAGAGG + Intergenic
929227153 2:39522517-39522539 TGGAACTGGGTAATGGGCAGAGG - Intergenic
929391166 2:41470708-41470730 TGGAACTGGGTAATGGGCATAGG + Intergenic
929634969 2:43510302-43510324 TGAATTTGGATGATGGGTAAAGG + Intronic
929654205 2:43714284-43714306 TGCAATTGTGAAATGGGAAGTGG - Intronic
930163117 2:48178132-48178154 TGGAACTGGGTAATGGGCAGAGG - Intergenic
930230027 2:48834205-48834227 TGGAACTGGGTAATGGGTAGAGG + Intergenic
930490020 2:52057781-52057803 TGGAAGTGGGTAATGGGAAGAGG + Intergenic
930949144 2:57116120-57116142 TAAAATTAGGTAATGGGTAGAGG + Intergenic
930954029 2:57182364-57182386 AGGAATTGGGGAAGGGGTAATGG - Intergenic
931109941 2:59099466-59099488 TGGAACTGGGTAATGGGCAGTGG - Intergenic
931140273 2:59449939-59449961 TGAAATTGGGTAGTGGGTAGAGG + Intergenic
931154011 2:59607409-59607431 TGGAACTGGGTAACAGGTAAAGG + Intergenic
932369918 2:71178459-71178481 TGAAACTGGGTAATATGTAAAGG + Intergenic
932799879 2:74731946-74731968 TGGAATTGGGGAAAGGGAAAAGG - Intergenic
932925184 2:75965153-75965175 TGAAACTGGGTAATGGGGAAAGG - Intergenic
933112485 2:78421214-78421236 TTAAACTGGGTAATAGGTAAAGG - Intergenic
933344591 2:81066793-81066815 TGGAACTGGGTAATAGGTACTGG - Intergenic
933367809 2:81376133-81376155 TGGAATTAGGTAATGGGTAGAGG + Intergenic
933481931 2:82868989-82869011 TGAAATTGGGTAACTGATAAAGG - Intergenic
933508213 2:83205104-83205126 TGGAACTGGGTAATGGGCAGAGG - Intergenic
933562916 2:83911638-83911660 TGAGATTGGGTAATGGGGAGAGG + Intergenic
933864248 2:86501405-86501427 TGGAACTGGGTAATGGGCAGAGG - Intergenic
934014274 2:87862371-87862393 TGCAATGTGGTAATAGGTAAGGG + Intergenic
934015920 2:87881701-87881723 TGGAACTGGATAATGGGCAAAGG - Intergenic
934060570 2:88288697-88288719 AGGGATTGGGTGATGGGTAATGG + Intergenic
934546174 2:95218560-95218582 TGGAACTGGGTGATGGGTAGAGG - Intronic
935870039 2:107438259-107438281 CGGAACTGGGTAATGGGTAGAGG + Intergenic
936161703 2:110088255-110088277 TGGAACTGGATAATGGGCAAAGG + Intronic
936182960 2:110283099-110283121 TGGAACTGGATAATGGGCAAAGG - Intergenic
936257437 2:110929092-110929114 TGAAACTGGGTAATAGGTAGAGG + Intronic
936644209 2:114350023-114350045 TGGAACTGAGTAATGGGTAGAGG - Intergenic
936800391 2:116258677-116258699 TGAAACTGGGTAATGGGCAGAGG - Intergenic
936940762 2:117882131-117882153 TGGAACTGGGTAATGGGCAGAGG + Intergenic
936994336 2:118397720-118397742 TGAAATTGGGTAATAGGCAGAGG + Intergenic
937480182 2:122250247-122250269 TGGAATTTGGTAATGGGTAGAGG + Intergenic
937591108 2:123614424-123614446 TGCTACAGGGAAATGGGTAAGGG - Intergenic
937688314 2:124723470-124723492 TGGAATTGGGTAATATGCAAAGG - Intronic
937942283 2:127295273-127295295 TCAAATTGGGTAATCGGTAGAGG + Intergenic
938260204 2:129890433-129890455 TGGAACTGGGTAATGGGTAGAGG - Intergenic
938768248 2:134478289-134478311 TGGAATTGGGTAATGGGCAGAGG + Intronic
938769134 2:134484773-134484795 GGCAATGGGGGAATGGTTAAAGG + Intronic
939324731 2:140673608-140673630 TTAAATTGGGTACTGGGTAGAGG - Intronic
939394832 2:141614951-141614973 TGGAATTGGGTAATGGGTAGAGG + Intronic
939565781 2:143785031-143785053 TGAAACTGGGTAATTGATAAAGG - Intergenic
939852825 2:147320627-147320649 TGGAACTGGGTAATGGGTAGAGG + Intergenic
940174703 2:150865225-150865247 TGGAACTGGGTAATGGCTAGAGG - Intergenic
940288825 2:152058320-152058342 TGGAACTGGGTAATGGGCAGAGG + Intronic
940394733 2:153174881-153174903 TGGAATTGGGTGATGGGTGAAGG - Intergenic
940597871 2:155818304-155818326 TGGAACTGGGTAATGGGCAGAGG + Intergenic
940698923 2:157017454-157017476 TGGAACTGGGTAATGGGTAGAGG - Intergenic
940810953 2:158242562-158242584 TGCAAGTGGGGAATGGCTCAGGG - Intronic
941478777 2:165980101-165980123 TGGAACTGGGTAATGGGTGAAGG + Intergenic
941888289 2:170552200-170552222 TGGAACTGGGTAATGGGCAGAGG + Intronic
942275833 2:174322920-174322942 TTCCATTGGGTATTTGGTAAAGG + Intergenic
942592119 2:177557330-177557352 TGGAATTGTGTAATGGGCAATGG + Intergenic
942991359 2:182207104-182207126 TGGAACTGGGTAATGGGCAGAGG + Intronic
943208610 2:184932302-184932324 TGAGATTGGGTAATGTATAAAGG + Intronic
943212656 2:184988150-184988172 TGGAACTGAGTAATGGGTAGGGG + Intergenic
943274785 2:185852791-185852813 AGGAACTGGGTAATGGGTAGAGG - Intergenic
943448055 2:188014703-188014725 TGGAACTGGGTAATGGGTAGAGG - Intergenic
943691220 2:190871538-190871560 TGAAACAGGGTAATGGGTAGAGG - Intergenic
943889826 2:193272378-193272400 TGGAACTGGGTAATGGGCAGAGG - Intergenic
943940488 2:193988078-193988100 TGGAATTGAATGATGGGTAAAGG + Intergenic
944057941 2:195543181-195543203 TGAAGTTGGGTAATGGGTGGAGG - Intergenic
944786189 2:203072789-203072811 TAGAACTGGGTAATGGGTAGAGG - Intronic
944936255 2:204572074-204572096 TGCAATTGGGGAAGGGAGAAAGG + Intronic
944995703 2:205291113-205291135 TGAAACTGGGTAATGGGTGGAGG + Intronic
945356197 2:208842637-208842659 TGGAACTGGGTAATGGGCAGAGG + Intronic
945457804 2:210069431-210069453 TGGAACTGGGTAATGAGCAAAGG - Intronic
945616346 2:212073278-212073300 TGCATTTGTGTCATGGGTAGAGG + Intronic
945623319 2:212170051-212170073 TGGAACTGGGTAATGGGCAGAGG + Intronic
945724763 2:213462909-213462931 TGGAACTGGGTAATAGGCAAAGG + Intronic
946468960 2:219938796-219938818 TGGAACTGGGTAGTGGGTAGAGG + Intergenic
946577069 2:221087205-221087227 TGGAATTGGGTAATGGGCAGAGG - Intergenic
946709680 2:222493065-222493087 TGGAACTGGGTAATGGGCAAAGG - Intronic
946898226 2:224346306-224346328 TGGAACTGGGTAATGGGCAGTGG - Intergenic
946995201 2:225383442-225383464 TGGAACTGGTTAATGGGCAAAGG + Intergenic
947197392 2:227582598-227582620 TGGAACTGGGTAATGGGCAGAGG + Intergenic
947249737 2:228089022-228089044 TGGAACTGGGTAATGGGAACAGG + Intronic
948773078 2:240262085-240262107 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1169333775 20:4738279-4738301 TGCAAGTGGGGAATGGAAAAAGG + Intronic
1169492278 20:6081419-6081441 TGCAAGTTGGCAAAGGGTAAGGG + Intronic
1169524943 20:6414077-6414099 TGAAATTGGGCAGTGGGCAAAGG + Intergenic
1170450952 20:16483106-16483128 TGAATTTGGGTAATGCGTTAGGG + Intronic
1170730040 20:18966018-18966040 TGGAATTAGCTAATGGGTAAAGG + Intergenic
1170883804 20:20320681-20320703 TTTAATTGGGTAATGGATGATGG + Intronic
1170938449 20:20829275-20829297 GGGAAGTGGGTAATGGGCAAAGG + Intergenic
1170941945 20:20855391-20855413 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1171322716 20:24260544-24260566 TGCAAATAGGAACTGGGTAAGGG - Intergenic
1172719556 20:36989135-36989157 TGGAATTGGGTAATGGGCAGAGG + Intergenic
1173033169 20:39381026-39381048 TCCATCTGTGTAATGGGTAAAGG - Intergenic
1175323786 20:58108386-58108408 TGCAACGGGGTAATAGGTAGAGG + Intergenic
1176601720 21:8800291-8800313 CGGAACTGGGTAATGGGTAGAGG - Intergenic
1176626248 21:9094437-9094459 CGGAACTGGGTAATGGGTAGAGG + Intergenic
1176647341 21:9363609-9363631 CGGAACTGGGTAATGGGTAGAGG - Intergenic
1177206311 21:18015566-18015588 TGGAATTGGATAATGGGCAGAGG + Intronic
1177211947 21:18082461-18082483 TGGAAGTGGGTAATGGGTAGAGG + Intronic
1177312149 21:19412044-19412066 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1177406255 21:20672565-20672587 TGCAGCTGGGTAATGGGCAGAGG + Intergenic
1177594200 21:23214041-23214063 TGCAAATGGATAATGGGCAGAGG - Intergenic
1177653475 21:23986703-23986725 TGGAATTGGGTAATAGGCAAAGG + Intergenic
1177765355 21:25451043-25451065 TGGAATTGGGTAACGGGCAGAGG - Intergenic
1177770217 21:25505569-25505591 TGCAATTGGGTCAGGGGAAAAGG - Intergenic
1177949551 21:27517416-27517438 TGCAATTGGGTAACAGGAAGAGG + Intergenic
1178127131 21:29527632-29527654 AGAGAATGGGTAATGGGTAATGG - Intronic
1178127137 21:29527657-29527679 GGGAACTGGGTAATGGGTAATGG - Intronic
1178628740 21:34240903-34240925 TGCAATTCCCTAATGGCTAACGG - Intergenic
1179370265 21:40800353-40800375 TGGAACTGGGTAATGGGCAGAGG + Intronic
1180344006 22:11691842-11691864 CGGAACTGGGTAATGGGTAGAGG - Intergenic
1180365579 22:11935382-11935404 CGGAACTGGGTAATGGGTAGAGG + Intergenic
1180486810 22:15808680-15808702 TGGAAGTGGGTAATGGGCAGAGG + Intergenic
1181896511 22:26112931-26112953 TGGAACTGGGTAATGGGGAGAGG - Intergenic
1181971551 22:26694277-26694299 TATAATTGGGTAATGTTTAAGGG + Intergenic
1182525900 22:30918979-30919001 TGGTAATGGGTAATGGGTAGCGG - Intergenic
1182650749 22:31849190-31849212 TGGAATTGGGTAACAGGCAAAGG - Intronic
1183044611 22:35209847-35209869 TGCTACTGGGTAATGGGAAGAGG - Intergenic
1183533362 22:38377739-38377761 TTCAATGGGGTAATAGCTAAAGG + Intronic
1184897176 22:47416866-47416888 TGGAACTTGGTAATGGGTAGAGG + Intergenic
950816077 3:15703757-15703779 TGGAACTGGGTAATGGATAGAGG + Intronic
950912746 3:16611816-16611838 TGGAACTGGGTAATGGGTAGAGG + Intronic
951745805 3:25976125-25976147 GGCAGTTGGGAAATGGGTAATGG - Intergenic
951999632 3:28771085-28771107 TGGAACTGGGTAATGGGCAGAGG + Intergenic
952339744 3:32435598-32435620 TGTAAGTGGGCAGTGGGTAAAGG + Intronic
952585341 3:34885991-34886013 TTGAACTGGGTAATGGGTAGAGG + Intergenic
952638590 3:35562796-35562818 TGGAATTGGGTAATGGGCAGAGG + Intergenic
952671657 3:35975593-35975615 TGAAACTGGGTAATGGGCAGAGG - Intergenic
952752563 3:36837136-36837158 TGCATTTGGGAACTGGGAAAAGG - Intronic
953168983 3:40490349-40490371 TGGAACTGAGTAATGGGTAGAGG + Intergenic
954264471 3:49461785-49461807 TGCAGTTGGGTGAGGGGTGAGGG - Intergenic
955511193 3:59681980-59682002 TGTAAATGGGAAATGGGTTAAGG - Intergenic
956041651 3:65151394-65151416 TGCAAAAGGGGAATGGGCAAGGG + Intergenic
956354571 3:68377203-68377225 TGGAACTGGGTAATGGGCAAAGG + Intronic
956401896 3:68888471-68888493 TGGAGTTGGGTAATGGGTAGAGG - Intronic
956473353 3:69592873-69592895 TGAAATTGGAGAATGGGGAAAGG + Intergenic
956524342 3:70141073-70141095 TGGAATTGGGTAATGCGTTGAGG - Intergenic
956551103 3:70460856-70460878 TGGAACTGGGTAATAGGCAAAGG + Intergenic
956584025 3:70844987-70845009 TGAAACTGGGTAATTTGTAAAGG - Intergenic
957248707 3:77745557-77745579 TGGAATTTGGTAATGGGAAGAGG - Intergenic
957467789 3:80617301-80617323 TGGAAGTGGGTAATGGGTACAGG - Intergenic
958005954 3:87812194-87812216 TGGAACTGGGTAATGGGCAGAGG + Intergenic
958057037 3:88426806-88426828 TGAGATTGGGTAATGTATAAAGG - Intergenic
958175198 3:89988757-89988779 TGAAATTGGGTAATAGGCACAGG + Intergenic
958196457 3:90247237-90247259 TGGAAATGGGTAATGGCTAAAGG - Intergenic
958270333 3:91491539-91491561 TGAAATTGGGTAATTTATAAAGG - Intergenic
958414267 3:93855248-93855270 TGGAATTGGGTAATGGGCAGAGG - Intergenic
958419649 3:93915870-93915892 TGGAACTGGGTAATGGCTAAAGG - Intronic
958543341 3:95509258-95509280 TGAAACTGGGTAATGGGCAGTGG + Intergenic
958560603 3:95743745-95743767 TGGAAGTGGGTAATGGGCAGAGG - Intergenic
958681983 3:97342989-97343011 TGGAATTGGGTAATGGGTATCGG + Intronic
958935495 3:100251517-100251539 TGAAACTGGGTAATGGGCAGAGG - Intergenic
959050997 3:101525098-101525120 TGGAACTGGGTAATGGGCAGAGG + Intergenic
959149377 3:102590433-102590455 TGGAACTGGGTAATGGGCAGAGG + Intergenic
959171484 3:102849120-102849142 TGTAACTGGGTAATGGGCAGAGG - Intergenic
959283550 3:104378893-104378915 TGGAACTGGGTAATGGGAAGAGG + Intergenic
959310556 3:104730282-104730304 TACAACTGGGTAATGAGTAGAGG - Intergenic
959311419 3:104742051-104742073 TGAAAGTGGGTAATGAGTAGTGG - Intergenic
959433335 3:106282905-106282927 TGGAGCTGGGTAATGGGTAGAGG + Intergenic
959509176 3:107190333-107190355 TGGAAGTGGGTAATGGGTAGAGG - Intergenic
959512769 3:107232997-107233019 TGGAACTGGGTAATAGGTAGAGG + Intergenic
959742664 3:109738218-109738240 TGGAACTGGGTAATGGGCAGAGG - Intergenic
959788306 3:110328180-110328202 TGGAACTGGGTAATGGGTAGAGG + Intergenic
959846495 3:111039822-111039844 TGGAAATGGGTAATAGGCAAAGG + Intergenic
960504071 3:118471748-118471770 TGAAATTGGATAATGGGTAGAGG - Intergenic
960820345 3:121724130-121724152 TGGAACTGGGTAATGGGCAGAGG + Intronic
962688205 3:137867799-137867821 TGGAACTGGGTCATGGGTACAGG - Intergenic
963525970 3:146413844-146413866 TGGAACTGGGTCATGGGTAGAGG - Intronic
963683662 3:148411319-148411341 AGCAAATTGGTAATGGGAAATGG - Intergenic
963777422 3:149453100-149453122 TGAAATTGGGTAATGGGCAAAGG - Intergenic
964154037 3:153563513-153563535 TGGAACTGGGTAATGGGCAGAGG + Intergenic
964268042 3:154922126-154922148 TGGAACTGGGTAATGGGCAGAGG - Intergenic
964271291 3:154959088-154959110 TGGAACTGGGTAATGGGCAGAGG - Intergenic
964279593 3:155049455-155049477 TGGAATTGGGAAATGAGTAGAGG + Intronic
965051928 3:163662450-163662472 TGGAACTGGATAATGGGTAGTGG + Intergenic
965192643 3:165550994-165551016 TAGAACTGGGTAATGGGTAGAGG + Intergenic
965635719 3:170778201-170778223 TGAAATTGGGTAGTGGATAGAGG + Intronic
965750720 3:171972143-171972165 TGGAACTGGGTAATAGGTAGAGG + Intergenic
965915772 3:173843809-173843831 TGGAATTGGGTAATAGGCAGAGG - Intronic
965950728 3:174305123-174305145 TAGAACTGGGTAATGGGTAGAGG - Intergenic
966029377 3:175326465-175326487 TGGAAGTGGATAATGGGTAAAGG - Intronic
966097792 3:176227408-176227430 TGGAACTGGGTAATGGGCAAAGG + Intergenic
966742838 3:183250173-183250195 TGGGATTGGGAAATGGTTAATGG - Intronic
967634060 3:191779503-191779525 TGAAATTGGGTAATTTATAAAGG - Intergenic
1202739539 3_GL000221v1_random:41378-41400 CGGAACTGGGTAATGGGTAGAGG + Intergenic
969107876 4:4821572-4821594 TGAAACTGGGTAATGGGCAGAGG + Intergenic
969157284 4:5222292-5222314 TCAAACTGGGTAATGGGTAGAGG + Intronic
970062399 4:12049969-12049991 TGGAATTGGGTAATGGGCAGAGG + Intergenic
970190225 4:13508954-13508976 TGGAACTGGGTAATGGGTAGAGG + Intergenic
970272521 4:14362521-14362543 TGCAATTGTGTAAATGCTAATGG - Intergenic
970461176 4:16276368-16276390 TGGAACTGGGTAATGGGCAGAGG + Intergenic
970659339 4:18266278-18266300 TGAAATTGAGTAATGGGCAGAGG - Intergenic
970698625 4:18708931-18708953 TGGAACTGGGTGATGGGTAGAGG - Intergenic
970801502 4:19977972-19977994 TGGAATTGGGTAAGAGGCAAAGG + Intergenic
970856354 4:20653041-20653063 TGAAACTGGGTAATGGGCAGAGG - Intergenic
971224311 4:24737048-24737070 TGGAACTGGGTAATGGGCAGAGG + Intergenic
971579137 4:28311068-28311090 AGCAATTGTGTAATGGTTGAGGG + Intergenic
971748437 4:30614332-30614354 TGAGACTGGGTAATGTGTAAAGG - Intergenic
971776130 4:30967853-30967875 TGGAATTGAGTAATGGGAACTGG + Intronic
972064669 4:34926000-34926022 TGTAACTGGGTAATGGCTAAAGG + Intergenic
972082554 4:35171880-35171902 GGAAACTGGGTAATGGGTAAAGG + Intergenic
972490944 4:39586683-39586705 TGCAACTGTGTAATGGATATAGG - Intronic
972682692 4:41322120-41322142 TGGAACTGGGTAATGGGCAGAGG - Intergenic
972809094 4:42563043-42563065 TGGAATTGGGTAATAGGCAGAGG + Intronic
972896033 4:43621036-43621058 TGGAACTGGGTAATGGGCAGAGG - Intergenic
972930169 4:44062737-44062759 TGCAACTGGGTAATGGGCAGAGG + Intergenic
973010663 4:45068965-45068987 TGGAACTGGGTAATGGGCAGAGG + Intergenic
973365048 4:49202098-49202120 CGGAACTGGGTAATGGGTAGAGG - Intergenic
973395544 4:49590356-49590378 CGGAACTGGGTAATGGGTAGAGG + Intergenic
974157676 4:58095223-58095245 TGCGATTGGGTAATTTATAAAGG + Intergenic
974198632 4:58610392-58610414 TGGAACTGGGTAATGGGTAGAGG + Intergenic
974510125 4:62828836-62828858 TGCATTTCCGTAATGGTTAATGG + Intergenic
974637910 4:64589567-64589589 TGGAATTGGGTAATGGGCAGGGG + Intergenic
974712001 4:65609711-65609733 TGCACTTGGATAATTGTTAAAGG - Intronic
974744811 4:66058146-66058168 TGGAATTGGGTAATGGGAAGAGG - Intergenic
974811489 4:66952031-66952053 TGGAAGTGGGTAATGGATAGAGG + Intergenic
974812072 4:66957599-66957621 TGGAACTGGGTAATAGGCAAAGG - Intergenic
974973911 4:68866297-68866319 TGGAACTGGGTAATGGGCAGAGG + Intergenic
975463066 4:74677121-74677143 TACAATTTGTTGATGGGTAATGG + Intergenic
975799084 4:78039951-78039973 TGGAATTGGGTAATGGGCACAGG + Intergenic
975981001 4:80159158-80159180 AACAATTGGTTAATGGGTAGAGG - Intergenic
976000883 4:80371896-80371918 TGGAACTGGGTAATGGGCAGAGG - Intronic
976598974 4:86920396-86920418 TGGAACTGGGTAATGGGTAGAGG - Intronic
976635562 4:87283572-87283594 TGGAATTGGGTAACAGGCAAAGG + Intergenic
976635882 4:87286035-87286057 TGGAACTGGGTAATGGGCATAGG + Intergenic
976853385 4:89575343-89575365 TGGAACTGGGTAATGGGCAGAGG + Intergenic
976949896 4:90814913-90814935 TGAAACTGGGTAATGGGCAGAGG - Intronic
977436589 4:97004417-97004439 TGGAACTTGGTAATGGGTAGAGG - Intergenic
977643954 4:99390499-99390521 TGGAACTGGGTAATGGGCAAAGG - Intergenic
977712554 4:100144417-100144439 TGGAATTGGGTAATGGATAAAGG + Intergenic
977783333 4:101005025-101005047 TGGAACTGGGTAATGGGCAGAGG + Intergenic
978455123 4:108880294-108880316 TACATTTGGGTAATAGGAAAAGG + Intronic
978526834 4:109676065-109676087 TGGAATTTGGTAATGGGCAAAGG + Intronic
978526884 4:109676576-109676598 TGGAATTTGGTAATGGGCAAAGG - Intronic
978986523 4:115020049-115020071 TGGAATTGGGTAACGGATACAGG + Intronic
979087116 4:116427502-116427524 TGGAATTGGGTAATGGGAGGAGG + Intergenic
979456022 4:120926854-120926876 TGGAATTCGGTAATGAGTAGAGG + Intergenic
979482472 4:121235725-121235747 TGGAGTTGGGTAAAAGGTAATGG + Intergenic
979601610 4:122591921-122591943 TGGAACTGGGTAATGGGCAGAGG - Intergenic
979610123 4:122681125-122681147 TGGAACTGGGTAATGGGCAGAGG + Intergenic
979610583 4:122684940-122684962 TGTTATTGTGTAATGGGCAATGG - Intergenic
979721357 4:123904389-123904411 TGAAACTGGGTAACGGGTAGAGG + Intergenic
979748161 4:124242995-124243017 TGGAGCTGGGTAATGGGTAAGGG + Intergenic
979752286 4:124294026-124294048 TGGTAATGGGTAATGGGTAGAGG + Intergenic
979867570 4:125775858-125775880 TGGAACTGGGTAATGGGCAGAGG + Intergenic
979951432 4:126898130-126898152 TGGAATTGGGTAATGGGCAGAGG - Intergenic
980090939 4:128442317-128442339 TGGAACTGGGTAATGGGCAGAGG - Intergenic
980247478 4:130266531-130266553 TGAAACTGGGTAATGGGCAGAGG + Intergenic
980901395 4:138908519-138908541 TGCAATGGGGTTCTGGGCAATGG + Intergenic
981052394 4:140322231-140322253 TGTAACTGGGTGATGGGTAGAGG + Intronic
981356965 4:143799985-143800007 TGGAACTGGGTAATGGGAAGAGG - Intergenic
981368497 4:143930583-143930605 TGGAACTGGGTAATGGGCAGAGG - Intergenic
981378293 4:144040870-144040892 TGGAACTGGGTAATGGGTAGAGG - Intergenic
981796779 4:148604703-148604725 TGGAGTTGGGTAATAGGTAGAGG + Intergenic
981872021 4:149498065-149498087 TGGAGTTGGGTACAGGGTAATGG - Intergenic
982101627 4:151974090-151974112 AGCAATTGGTTATTGTGTAAAGG - Intergenic
982162782 4:152586678-152586700 TGAAACTGGGTAATGGGCAGAGG + Intergenic
982331388 4:154185422-154185444 TGGAACTCGGTAATGGGTAGAGG + Intergenic
982428956 4:155299456-155299478 TGGAACTGGGTAATGGGCAGAGG - Intergenic
982598449 4:157415036-157415058 TGGAACTGTGTAATGGGTAGAGG - Intergenic
982607709 4:157536059-157536081 TGAAACTGAGTAATGGGTAGAGG + Intergenic
982790673 4:159587612-159587634 TGGAACTGGGTAATAGGCAAAGG - Intergenic
982912721 4:161165182-161165204 TGTAACTGGGTAATGGGTTGTGG - Intergenic
983474975 4:168202791-168202813 TGGAATTGGGTAATGGGCAGAGG + Intergenic
983665400 4:170176504-170176526 TGGAACTGAGTAATGGGCAAAGG + Intergenic
984721455 4:182977022-182977044 TGGAAATGGATAATGGGTAGAGG + Intergenic
985616987 5:928716-928738 TGGAACTGGGTAACAGGTAAAGG + Intergenic
985617913 5:935532-935554 TGGAATTGGGTCATGGGAAGAGG - Intergenic
986138345 5:5004997-5005019 TGGAATTGGGTAATAGGCAGAGG + Intergenic
986205641 5:5622728-5622750 TGGAACTGGGTAATGGGCAGAGG + Intergenic
986281791 5:6329421-6329443 TGGAACTGGGTAATGGGCAGAGG + Intergenic
986563224 5:9084785-9084807 TGGAACTGGGTAATAGGTAGAGG + Intronic
986609734 5:9554393-9554415 TGGAACTGGGTAATGGGTAGAGG - Intergenic
986916261 5:12624363-12624385 TGGAACTGGGTAATGGGAAGAGG + Intergenic
986948122 5:13048781-13048803 TGCAACTGGGTAAAGGGCAGAGG - Intergenic
987003694 5:13687828-13687850 TGAAACTGGGTAATGGGCAGAGG + Intergenic
987196824 5:15535303-15535325 TGGAACTGGGTAATGGGCAGAGG + Intronic
987201809 5:15584662-15584684 TGAAATTGGGTAATGGGCAGAGG - Intronic
987386476 5:17334430-17334452 TGAAATTGGGTAATTTGTAAAGG + Intergenic
987459944 5:18197296-18197318 TGGAACTGGGTAATGGGTAGAGG + Intergenic
987461906 5:18222610-18222632 TGGAACTGGGTAATGGGCAGAGG + Intergenic
987494945 5:18631253-18631275 TGGAACTGGGTAATGGGCAGAGG - Intergenic
987511766 5:18848487-18848509 TGGAATTGGGTAACAGGCAAAGG - Intergenic
987650932 5:20739312-20739334 TGGGATTGGGTAGTGGGTAGAGG - Intergenic
987689139 5:21244579-21244601 TGGAACTGGGTAATGAGCAAAGG + Intergenic
987807387 5:22786639-22786661 TTCATTTGTGTAATGGGGAAGGG + Intronic
988009500 5:25464271-25464293 TGGAACTGGGTAATGGGCAGAGG + Intergenic
988068289 5:26251498-26251520 TGGAACTGGGTAATGGGTAGAGG - Intergenic
988085359 5:26468745-26468767 TGAAACTGGGTAATGGGTAGAGG + Intergenic
988354268 5:30152401-30152423 TGAAGCTGGGTAATGAGTAATGG - Intergenic
988647191 5:33107650-33107672 TGGAATTGGGTAACAGGCAAAGG + Intergenic
988744622 5:34122156-34122178 TGGGATTGGGTAGTGGGTAGAGG + Intronic
989308011 5:39979972-39979994 TGGAACTGGGTAATGGTTAGAGG + Intergenic
989348675 5:40458849-40458871 TGCAACTGGATAATGGGTAGAGG + Intergenic
989662533 5:43815115-43815137 TGGAACTGGGTAATGGGCAGAGG + Intergenic
989718953 5:44502276-44502298 TGCAATAGGGGAAGGGGAAAGGG - Intergenic
989726703 5:44596327-44596349 TGAAATTGGGTAATTTATAAAGG + Intergenic
990108535 5:52293957-52293979 TGGAACTGGGTAATGGGCAGAGG - Intergenic
990884531 5:60576348-60576370 TGGAACTGGGTAATGGGCAGAGG - Intergenic
991007584 5:61844988-61845010 TGGAACTGGGTAATGGGTAGCGG + Intergenic
991122483 5:63032339-63032361 TGGAACTAGGTAATGGGTAGAGG + Intergenic
991186475 5:63814734-63814756 TGCAACTGGGTAATGGGTAGAGG + Intergenic
991250057 5:64550122-64550144 TGGAACTGGGTAATGGGTAGAGG - Intronic
991600559 5:68347999-68348021 TGGAACTGGGTAATGGGCAGAGG + Intergenic
991776192 5:70088346-70088368 TGGAACTGGGTAATGAGTAGTGG + Intergenic
991855480 5:70963800-70963822 TGGAACTGGGTAATGAGTAGTGG + Intergenic
991869490 5:71096573-71096595 TGGAACTGGGTAATGAGTAGTGG + Intergenic
992041427 5:72837072-72837094 TGCAATTGGGTAATGGGTAAAGG - Intronic
992666381 5:79013484-79013506 TGGAACTGGGTAATGGGCAGAGG - Intronic
992750540 5:79856931-79856953 TGCAGGTGGGAAACGGGTAATGG + Intergenic
993227611 5:85187161-85187183 TGAAATTGCTTAATGGGTAGGGG + Intergenic
993358843 5:86947985-86948007 TGAAACTGGGTAATGGGTAGAGG - Intergenic
993580193 5:89651940-89651962 TGGAACTGGGTAATGGGCAAAGG + Intergenic
993938479 5:94031133-94031155 TGGAACTGAGTAATGGGTAGTGG + Intronic
994425844 5:99586192-99586214 TGGAATTTGGTCATGGGTAGAGG + Intergenic
994570020 5:101504142-101504164 TGCAAATGGGTAACGGGTAGAGG + Intergenic
994592216 5:101787980-101788002 TGGAACTGGGTAATGGGCATAGG + Intergenic
995058411 5:107787839-107787861 TGGAACTGGGTAATGGATACAGG + Intergenic
995135358 5:108674415-108674437 TGGAATTGGATACTGGGTAGAGG - Intergenic
995559543 5:113365537-113365559 TGGAACTGGGTAATGGGCAGAGG - Intronic
995608352 5:113882130-113882152 TGGAACTGGGTAATGGGCAGAGG + Intergenic
995779906 5:115763768-115763790 TGCAACTGGGTAATGGGCAGAGG - Intergenic
995971327 5:117974589-117974611 TGAAACTGGGTAATGGGCAGAGG - Intergenic
996159601 5:120146182-120146204 TGGAACTGGGTAATGGGCAGAGG - Intergenic
996222712 5:120953015-120953037 TGGAACTGGGTAATAGGTAGAGG + Intergenic
996453807 5:123657094-123657116 TGGAAATGGGTAATGGGCAGAGG - Intergenic
996633688 5:125666162-125666184 TTTAAATGGGTAATGGGTGAAGG + Intergenic
996834498 5:127776089-127776111 TGGAACTGGGTAATGGGCAGAGG + Intergenic
997090035 5:130846066-130846088 TGGAGCTGGGTAATGGGTAGAGG - Intergenic
997110142 5:131065855-131065877 TGGAACTGGGTAATGGGCAGAGG + Intergenic
997121036 5:131173240-131173262 TGGAATTGAGTAATGTGTAGAGG - Intronic
997273658 5:132564163-132564185 TGGAACTGGGTAATGGGTAGAGG + Intronic
997573737 5:134956470-134956492 TCCACTTGGCTAATGGGAAATGG + Intronic
997922910 5:137999573-137999595 TGGAACTGGGTAATGGATAGAGG - Intronic
998032792 5:138886656-138886678 TGCAAGTGTGTAATGAGTATAGG - Intronic
998487581 5:142516549-142516571 TGGAACTGGGTAATGGGCAGAGG + Intergenic
998574394 5:143298064-143298086 TGCAATGAGGTAAGGGGAAATGG + Intronic
998725051 5:145003027-145003049 TGGAGCTGGGTAATGGGTGAAGG + Intergenic
999571459 5:152924595-152924617 TGCAACTGGGTAATGTGCACAGG + Intergenic
999676494 5:154008892-154008914 TACAAATGTGTAATGGGGAAAGG + Intronic
999841896 5:155436732-155436754 TGGAATAGGGTAATGGGGAGAGG + Intergenic
999843142 5:155450425-155450447 TGGAACTGGGTAATGGGCAGAGG - Intergenic
999909993 5:156187282-156187304 TTCAATAGGATAATGGGAAATGG + Intronic
1000284112 5:159811780-159811802 TGAAACTGGGTAATGGGTTGAGG + Intergenic
1000292410 5:159882781-159882803 TGCAATTAGTTAATTGGCAAAGG + Intergenic
1000503412 5:162081674-162081696 TGCATTTGCCTAATGGGTAATGG - Intronic
1000548957 5:162635006-162635028 TGGAATTGGGTAATGGGAAGAGG - Intergenic
1001474234 5:172038561-172038583 TGGAACTGGGTAATGGGTAGAGG - Intergenic
1001680109 5:173550408-173550430 TGCAAGTGGGTAAAGGTGAAGGG + Intergenic
1003058588 6:2844157-2844179 TGAAACTGAGTAATGGGTAGAGG - Intergenic
1003142079 6:3480180-3480202 TGAAACTGGGTAATGGCTAGAGG - Intergenic
1004568874 6:16825546-16825568 TGCACTGGGGTAATTGGAAAAGG + Intergenic
1004588291 6:17024594-17024616 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1004949025 6:20647409-20647431 TGCAAGTAGGTAAAGGGTGAGGG - Intronic
1004953794 6:20704403-20704425 TGAAATAAGGTAATGAGTAATGG + Intronic
1005113849 6:22314910-22314932 TGGAACTGGTTAATGGGTAGAGG - Intergenic
1005467906 6:26133059-26133081 TGGAAATTGGTGATGGGTAAAGG - Intronic
1006250579 6:32780025-32780047 TGGAACTGGGTAATGGGTAGAGG - Intergenic
1006541097 6:34740594-34740616 TGCAATTGTGCAATGGGGCAGGG - Intergenic
1006576704 6:35051721-35051743 GGCAACTGGGAGATGGGTAAGGG + Intronic
1006705145 6:36013500-36013522 TGCAATTGGCAAGTGGGTAGAGG + Intronic
1007088167 6:39165311-39165333 TGGAATTGGATAATGGGTGGAGG + Intergenic
1007523317 6:42468415-42468437 TAGAACTGGGTAATGGGTAGAGG - Intergenic
1007933440 6:45712744-45712766 TGAATTTGAGTAATGGGTAGGGG + Intergenic
1008098966 6:47371078-47371100 TGGAACTGGGTAATGGGCATAGG + Intergenic
1008789915 6:55217822-55217844 TGGAAATGGGTAATGGACAAAGG - Intronic
1008984815 6:57529816-57529838 TGAAATTGGGTAATTTATAAAGG + Intronic
1009172864 6:60422760-60422782 TGAAATTGGGTAATTTATAAAGG + Intergenic
1009395149 6:63191210-63191232 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1009650759 6:66475258-66475280 TGTAATTGGTTAATGAGTGATGG + Intergenic
1009791300 6:68404492-68404514 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1010040582 6:71378324-71378346 TGCATGTGGGTGAAGGGTAAGGG + Intergenic
1010659882 6:78557145-78557167 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1010810520 6:80294069-80294091 TGGAATTGGGTAATAGGCAGAGG - Intronic
1011081128 6:83491142-83491164 TGGAACTGGGTAATGGGTAGAGG - Intergenic
1011129658 6:84040438-84040460 TGGAACTGGGTAATGGGCAGAGG + Intronic
1012121003 6:95366792-95366814 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1012170131 6:96006633-96006655 TGGAACTGGGTAATGGGTAGAGG + Intergenic
1013088529 6:106877119-106877141 TGGAATTGGATAATGGATAGAGG - Intergenic
1013729992 6:113154134-113154156 TGGAACTGGGCAATGGGCAAAGG + Intergenic
1013865672 6:114693409-114693431 TGGAACTGGGTAATGGGTATAGG + Intergenic
1015223995 6:130835617-130835639 GGCAATTTGGTAATGGGAAAAGG + Exonic
1015252459 6:131141578-131141600 TGGAACTGGGTAATGGGCAGGGG + Intronic
1015347386 6:132175741-132175763 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1015351457 6:132224795-132224817 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1015968058 6:138715017-138715039 TGCAACTGGGTAATGGGCAGAGG - Intergenic
1016124729 6:140386122-140386144 TGCAACTGGGTAATGGGCAGAGG - Intergenic
1016151329 6:140746044-140746066 TGCCACTGGGTAATAGGCAAAGG + Intergenic
1016785843 6:148010273-148010295 TGGAATTGGGTAATGGGCAGAGG + Intergenic
1017567376 6:155701896-155701918 AGCAAATGGGTACTTGGTAAAGG - Intergenic
1017870819 6:158484971-158484993 TGGAACTGGGTAATGGATATAGG + Intronic
1018043344 6:159944431-159944453 TGGAACTGGATAATGGGTAGAGG + Intergenic
1018502040 6:164421722-164421744 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1018535545 6:164814992-164815014 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1018714373 6:166520630-166520652 TGGAAATGGGTAATGGGTAGAGG + Intronic
1019026770 6:168972331-168972353 TGGAACTGGGTAATGGGTGGAGG - Intergenic
1020230105 7:6311843-6311865 AGCAATTGCTTAATGGGTACAGG + Intergenic
1020407782 7:7856137-7856159 TGGAATTGGGTAATGGGCAGAGG - Intronic
1020495430 7:8845756-8845778 TAGAACTGGGTAATGAGTAAAGG + Intergenic
1020573479 7:9896055-9896077 TGTAACTGGGTAATGGGCAGAGG + Intergenic
1021662274 7:22931502-22931524 TGGAATTGGTTAATGGGTAGAGG + Intergenic
1022564694 7:31385967-31385989 TCCACTTGAGAAATGGGTAAAGG + Intergenic
1022857970 7:34334715-34334737 TGGAATGGAGTAATGGGCAAAGG - Intergenic
1023139716 7:37089885-37089907 TACTAATGGGTAATGGGTAATGG + Intronic
1023235559 7:38082392-38082414 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1023275478 7:38514898-38514920 TAGAATTGGGTAATGGATAGAGG + Intronic
1023275576 7:38515680-38515702 TGGAACTGGGTATTGGGTAGAGG + Intronic
1024218749 7:47270519-47270541 TGGAATTGGGTAATGTGTAGAGG - Intergenic
1024414182 7:49083018-49083040 TGGAACTGCGTAATGGGTAGAGG - Intergenic
1024577550 7:50776971-50776993 TGGAATTGGGTAATGGGTAGAGG - Intronic
1024762185 7:52612141-52612163 TGGAACTGGGTGATGGGTAAAGG - Intergenic
1024778889 7:52822683-52822705 TGAAACTGGGTAATGGGCAGAGG - Intergenic
1025106135 7:56173808-56173830 TGCCACTGGGTGATGGGTATGGG + Intergenic
1025729522 7:64097631-64097653 TGGAATTGGGTAATTTATAAAGG + Intronic
1026316309 7:69230700-69230722 TGCCACTGGGTGATGGGTATGGG + Intergenic
1026425006 7:70282228-70282250 TGGAACTGGGTGATGGGTAGAGG - Intronic
1027341248 7:77210557-77210579 TGGAACTGGGTAATGGGCAGAGG - Intronic
1027584916 7:80045593-80045615 TGGAATTGGGTAATAGGCAGAGG - Intergenic
1027754222 7:82190578-82190600 TGCAGTTGGATGATGGGTAAGGG - Intronic
1028148679 7:87346781-87346803 TGCATTTGTGTAATTGGTTAAGG - Intronic
1028370808 7:90090013-90090035 ATTATTTGGGTAATGGGTAATGG - Intergenic
1029005275 7:97202846-97202868 TGTAATGGGATAATGGTTAAAGG - Intergenic
1029794982 7:102884768-102884790 AGCAATTGCTTAATGGGTACAGG - Intronic
1030381098 7:108812855-108812877 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1030752041 7:113240577-113240599 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1031653691 7:124324785-124324807 TCCTAGTGAGTAATGGGTAAAGG - Intergenic
1031718115 7:125133989-125134011 TGGAACTGGGTAATTGATAAAGG + Intergenic
1032430356 7:131855958-131855980 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1032636408 7:133713885-133713907 TGAAATTGGGTAATTTATAAAGG - Intronic
1033063558 7:138130362-138130384 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1033554980 7:142481376-142481398 GGCAAATGGGTAATGGATAGAGG + Intergenic
1033716566 7:144008906-144008928 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1034710492 7:153186875-153186897 TGGAAGTGGGTAATGGGCAGAGG - Intergenic
1035981811 8:4381019-4381041 GGCAAATGGGAAATGGGTTAAGG + Intronic
1037347292 8:17913960-17913982 CGCAATTGGGAAATGGGAAGAGG - Intergenic
1037365944 8:18122581-18122603 TGAAACTGGGTAATGGGTGGGGG - Intergenic
1037393433 8:18418108-18418130 TGGAATTGAGTCCTGGGTAAAGG - Intergenic
1037610468 8:20471825-20471847 TGGAATTGGGTGATGGATAAAGG + Intergenic
1037744822 8:21634442-21634464 TGGAACTGGGTGATGGGTAGAGG + Intergenic
1038380727 8:27090765-27090787 TGCAGCTGGGTAATGGGTACAGG - Intergenic
1038684230 8:29701710-29701732 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1038759768 8:30375604-30375626 TGGAACTGGGTAGTGGGTAGAGG - Intergenic
1039370803 8:36982144-36982166 TGCAATGCTGAAATGGGTAAGGG - Intergenic
1039414938 8:37385834-37385856 TACATGTGGGTCATGGGTAAGGG - Intergenic
1039647882 8:39307041-39307063 TGAGACTGGGTAATGGGTAGAGG - Intergenic
1039655556 8:39400983-39401005 TGGGACTGGGTAATGGGTAGAGG - Intergenic
1040425727 8:47283893-47283915 TGAAATTGGTGAATTGGTAAAGG + Intronic
1040586556 8:48748798-48748820 TGGAACTAGGTAATGGGTAGGGG + Intergenic
1040823279 8:51589328-51589350 TGGAACTGGGTAATGGGTAAAGG + Intronic
1040957703 8:52996420-52996442 TGAAACTGAGTAATGGGTAGAGG - Intergenic
1041300237 8:56404001-56404023 TGGAACTTGGTAATGGGTAGAGG + Intergenic
1041406487 8:57504947-57504969 TGGAACTGGGTAATGGATAAAGG + Intergenic
1041632179 8:60100447-60100469 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1041984935 8:63910196-63910218 TGCAACTGGGTAACAGGCAAAGG - Intergenic
1041998425 8:64091445-64091467 TGGAATTAGGTAATTGGTAGAGG + Intergenic
1042071725 8:64942270-64942292 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1042161709 8:65903770-65903792 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1042424529 8:68632024-68632046 TGGAACTGGGTAATGGGCAGTGG + Intronic
1042501746 8:69516067-69516089 TGGAACTGGGTAATGGGCAGAGG - Intronic
1042761417 8:72275713-72275735 TGGAATTGGGTAACAGGTAGGGG + Intergenic
1043138425 8:76557418-76557440 TAAAACTGGGTAATGGGTAGAGG + Intergenic
1043946116 8:86254692-86254714 TGCAACTGGGTAATGGGTAAAGG - Intronic
1044164613 8:88966703-88966725 TGGAACTGGGTAATGGATAGAGG + Intergenic
1044295032 8:90517993-90518015 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1044886437 8:96783161-96783183 TGAAATTGGGTAACGGGGAGAGG - Intronic
1045067124 8:98459008-98459030 TGGAACTGGGTAATGGGCAGAGG + Intronic
1045617994 8:103940049-103940071 TGGAACTGGGTAATGGGCAGGGG - Intronic
1046272850 8:111918497-111918519 TAGAATTGGGTAATGGGTAGAGG - Intergenic
1046314151 8:112478281-112478303 TAGAAATGGGTAATGGGCAAAGG + Intronic
1046495793 8:115011456-115011478 TGCAACTGGGTAATGGGCAGAGG - Intergenic
1046735055 8:117767960-117767982 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1046863251 8:119118051-119118073 TGGAATTGGGTAATGGGCAGAGG - Intergenic
1047012398 8:120686185-120686207 TGGAACTGGGTAATGGGTAGAGG - Intronic
1047151188 8:122265050-122265072 TGCAACTGGGTAATTTATAAAGG + Intergenic
1047923484 8:129658600-129658622 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1047938730 8:129807085-129807107 TGAAACTGGGTAATGGGCAGAGG + Intergenic
1048043421 8:130751982-130752004 TGGAATTGGGTAATGGGCAGAGG - Intergenic
1048130831 8:131695057-131695079 TGGAACTGGGTAATGGGCAAAGG - Intergenic
1048181889 8:132202837-132202859 TGCAACTAGGTAATGGGCAGAGG - Intronic
1048190616 8:132285151-132285173 TGGAACTGGGTAATGGGTCGGGG + Intronic
1048213324 8:132475296-132475318 TGGAACTGGGTAATGGGCAGAGG + Intronic
1048755341 8:137732148-137732170 TGAAACTGGGTAATGAGTCAAGG + Intergenic
1050148250 9:2592780-2592802 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1050605099 9:7292838-7292860 TGAAGCTGGGTGATGGGTAATGG + Intergenic
1050996958 9:12232643-12232665 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1051079065 9:13275594-13275616 TGGAACTGGGTAATAGGTAATGG + Intronic
1051869137 9:21716230-21716252 TGGAACTGGGTAATGGGTAGAGG - Intergenic
1051964884 9:22815659-22815681 TGGAACTGGGTAATGGATAGAGG + Intergenic
1052509322 9:29394867-29394889 TGTAATTAGGAAATGGGCAAAGG + Intergenic
1052592234 9:30513428-30513450 TGGAACTGGGTAATGGGAAGAGG + Intergenic
1052829073 9:33200141-33200163 TGCAATTGGGTAAAGGAGTAAGG - Intergenic
1053089744 9:35264070-35264092 TGGAACTGGGTGATGGGTAGAGG + Intronic
1053604306 9:39641298-39641320 TGGAACTGAGTAATGGGTAGAGG - Intergenic
1053862125 9:42397348-42397370 TGGAACTGAGTAATGGGTAGAGG - Intergenic
1054249234 9:62701116-62701138 TGGAACTGAGTAATGGGTAGAGG + Intergenic
1054563345 9:66735648-66735670 TGGAACTGAGTAATGGGTAGAGG + Intergenic
1054746516 9:68859230-68859252 TGCATTTGGGTAATATGTTATGG - Intronic
1055073094 9:72187631-72187653 TGGAACTGGGCAATGAGTAAAGG + Intronic
1055078847 9:72246712-72246734 TGCATTGGGGTAAGGGGTAAGGG + Intronic
1055171524 9:73265160-73265182 TGGAACTGGGTAATGGGTAGTGG + Intergenic
1055209936 9:73779462-73779484 TGGAATTGGGTGATAGGCAAAGG + Intergenic
1055525606 9:77130154-77130176 TGGAACTGGGTAATGGGTAGAGG - Intergenic
1055528629 9:77160384-77160406 GGCAAATGGGAAATGGGTTAAGG + Intergenic
1055701061 9:78946409-78946431 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1055793980 9:79954565-79954587 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1056240200 9:84637861-84637883 TGCAATTGAGTTATGGCCAATGG + Intergenic
1056412023 9:86338822-86338844 TGCATTTAGGTACTGGGCAAAGG - Exonic
1057325828 9:94062406-94062428 TGGAACTGGGTAATGGGCAGAGG - Intronic
1057330801 9:94113084-94113106 TGGAACTGGGTAATGGGTTGAGG + Intergenic
1057642142 9:96834821-96834843 TGGAACTGGGTAATGGGTAGTGG + Intronic
1058174430 9:101721491-101721513 TGGAACTGGGTAATGGGCAGAGG + Intronic
1058208324 9:102135639-102135661 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1058385257 9:104428608-104428630 TGGAACTGGGTAATGGGAAGAGG + Intergenic
1058499180 9:105592938-105592960 TGGAACTGGGTAATAGGCAAAGG - Intronic
1059186968 9:112283235-112283257 TGGAACTGGGTAATGGGCAGAGG + Intronic
1059753982 9:117275244-117275266 TGGAATTAAGTAATGGGTAGAGG - Intronic
1059848794 9:118312880-118312902 TGTAACTGGGTAATTTGTAAAGG + Intergenic
1203749422 Un_GL000218v1:64856-64878 CGGAACTGGGTAATGGGTAGAGG + Intergenic
1203708184 Un_KI270742v1:71335-71357 CGGAACTGGGTAATGGGTAGAGG + Intergenic
1185893543 X:3840032-3840054 TGGAATTGGGTAATAGGCAGAGG + Intronic
1185898659 X:3878456-3878478 TGGAATTGGGTAATAGGCAGAGG + Intergenic
1185903775 X:3916885-3916907 TGGAATTGGGTAATAGGCAGAGG + Intergenic
1186240718 X:7562581-7562603 TGCAAAAGGAGAATGGGTAAAGG + Intergenic
1186915293 X:14212574-14212596 TGCATTTGGGGAAAGGGAAAAGG - Intergenic
1187612373 X:20956369-20956391 TGGAACTGAGTAATGGGTAGAGG - Intergenic
1187639763 X:21274987-21275009 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1187944666 X:24414671-24414693 TGAAACTAGGTAATGGGTAGAGG + Intergenic
1188069803 X:25704934-25704956 TGGAACTGGGTAATGGGAAGAGG + Intergenic
1188238338 X:27755434-27755456 TGGAACTGGGTAATGGGAAGAGG - Intergenic
1188305900 X:28559501-28559523 TGGAACTGGGTAATGGGCAAAGG - Intergenic
1188517637 X:31004682-31004704 TGGAACTGGGTAATGAGTAGAGG - Intergenic
1188807935 X:34614502-34614524 TGGAACTGGGTAATGGGAAGAGG - Intergenic
1188934339 X:36154838-36154860 TGGAACTGGGTAATAGGTAGGGG - Intergenic
1188964631 X:36536335-36536357 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1189080053 X:37961102-37961124 TGGAATTGGGTGATGGGTAGAGG - Intronic
1189086054 X:38025752-38025774 TTAAAATGTGTAATGGGTAAGGG + Intronic
1189656726 X:43252205-43252227 TGGAACTGGGTAATGGGAAGTGG - Intergenic
1189666316 X:43358622-43358644 TGGAACTGGGTAATGGGTAGAGG - Intergenic
1189789061 X:44586068-44586090 TGGAATTGGGTAGTGAGTAGAGG + Intergenic
1189815670 X:44822273-44822295 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1189973551 X:46440968-46440990 TGAAATTGGGTAATGGTTAGAGG - Intergenic
1190145564 X:47888720-47888742 TGGAATTGGGTAACGGGTAGAGG + Intronic
1190224111 X:48532580-48532602 TGGAACTGGGTAATGGGTAGAGG - Intergenic
1190481526 X:50881921-50881943 TGGAACTGGATAATGGGTAGCGG - Intergenic
1190710397 X:53064139-53064161 TGGAACTGGGTAATGGGTAGAGG - Intronic
1190959033 X:55227311-55227333 TGGAACTGGGTAATGGGCAGAGG + Intronic
1191656464 X:63604141-63604163 TGGAACTGGGTAATGGGCATAGG + Intergenic
1191877629 X:65812264-65812286 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1192071937 X:67950200-67950222 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1192249519 X:69399869-69399891 TGGAACTGGGTAATGGGTAGAGG - Intergenic
1192565455 X:72159603-72159625 TGGAAATGGGTAATGGGCAGAGG - Intergenic
1192705207 X:73522157-73522179 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1193046275 X:77058209-77058231 TGGAACTGGGTAATGGGCACAGG + Intergenic
1193140151 X:78018610-78018632 TGGAACTGGGTAATGGGCAGAGG - Intronic
1193175678 X:78389475-78389497 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1193329180 X:80216751-80216773 TGCAACTGGGTAATGGGCACAGG + Intergenic
1193412618 X:81182856-81182878 TGGAACTGGGTAATGGGAACTGG + Intronic
1193455889 X:81730690-81730712 TGAAATTGGGTAATTTATAAAGG - Intergenic
1193643584 X:84040722-84040744 TGAAACTGGGTAATGGGCAGAGG - Intergenic
1193724919 X:85026910-85026932 TGCAACTGGGTAATGGACAGAGG - Intronic
1193827191 X:86241115-86241137 TGGAACTGGGTAATGGGCAGAGG + Intronic
1193861301 X:86671812-86671834 TGAAACTGGGTAATGGGCAGAGG + Intronic
1193944021 X:87709761-87709783 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1193963019 X:87948402-87948424 TGGAATTGGGTGAGTGGTAATGG + Intergenic
1193978382 X:88151370-88151392 TAGAACTGGGTAATTGGTAAAGG - Intergenic
1194108140 X:89797489-89797511 TGAAGCTGGGTAATGGGTAGAGG + Intergenic
1194347791 X:92787109-92787131 TGGAATTGGGTAGTGGGCAGAGG - Intergenic
1194372210 X:93088199-93088221 TGCAACTGGTTAATGGGCAGAGG + Intergenic
1194509215 X:94771647-94771669 TGGAACTGGTTGATGGGTAAAGG + Intergenic
1194794513 X:98194638-98194660 TGGAATTGGGTAATTTGTAGAGG - Intergenic
1194893179 X:99405964-99405986 TGGAACTGGGTAATAGGTAGAGG + Intergenic
1194982235 X:100452631-100452653 TGAAACTGGGTAATGGGCAGAGG + Intergenic
1195022201 X:100840457-100840479 TGCTATTGGGAAGTGGGTGAGGG - Intronic
1195173905 X:102296499-102296521 TGTAATTGGGTAATGACTAGAGG + Intergenic
1195184960 X:102390594-102390616 TGTAATTGGGTAATGACTAGAGG - Intronic
1195513519 X:105745310-105745332 TGGAACTGGGTAATGGATAGAGG - Intronic
1195634792 X:107101856-107101878 TAGAATTGGGTAATGAGTAGAGG + Intronic
1195650485 X:107278328-107278350 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1195866686 X:109439986-109440008 TGGAACTGGGTAATGGGGAGAGG - Intronic
1196066724 X:111472072-111472094 TGGAACTGGGTAATGGGCAAAGG - Intergenic
1196066756 X:111472298-111472320 TGGAAATGGGTAATGGGCAGAGG - Intergenic
1196390746 X:115204866-115204888 TGGAACTGGGTAATGGGCAGAGG - Intronic
1196396504 X:115268531-115268553 TGGAACAGGGTAATGGGAAATGG - Intergenic
1196601343 X:117604771-117604793 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1197040845 X:121933468-121933490 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1197042133 X:121949746-121949768 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1197367477 X:125581799-125581821 TGACATTGGATAATGGGTAGAGG + Intergenic
1197473505 X:126891756-126891778 TGGAACTGGGTAATGGATAGAGG - Intergenic
1197599158 X:128507385-128507407 TGGAATTGAGTAATGGGTAGAGG + Intergenic
1197820017 X:130532841-130532863 TGTAATTGGGTAATGGGCAGAGG - Intergenic
1197925575 X:131643867-131643889 TGCAACTGGGTAATGGGTTGAGG - Intergenic
1198079082 X:133221687-133221709 TAGAACTGGGTAATGAGTAAAGG - Intergenic
1198170585 X:134101544-134101566 TGGAACTGGGTAATGGATACAGG + Intergenic
1198381553 X:136088531-136088553 TGGAATCGGGTAATGGGTAGAGG + Intergenic
1198585896 X:138121991-138122013 TGCAGATGGTTAATGGGTACAGG - Intergenic
1198588457 X:138149059-138149081 TGGAGCTGGGTAATGGGTATAGG + Intergenic
1198647973 X:138830153-138830175 TGGAACTGGGTAATGGGCAGAGG + Intronic
1198741741 X:139850151-139850173 TGGAACTGGGTAATGGGTAGGGG + Intronic
1198839873 X:140844910-140844932 TGGAATTGAGTGATGGGTAGAGG + Intergenic
1198913495 X:141639265-141639287 TGGAACTGGGTAATGGGCAGAGG - Intronic
1198943612 X:141985499-141985521 TGGAACTGGGTAATGGGCAGAGG + Intergenic
1199038331 X:143079609-143079631 TGCAATTGGGTAACAGGCAGAGG - Intergenic
1199128572 X:144156845-144156867 TGGAACTGGATAATGGGCAAAGG + Intergenic
1199130199 X:144176102-144176124 TGCAATGTGGTAATAGGTAAGGG - Intergenic
1199207028 X:145160795-145160817 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1199334836 X:146606555-146606577 TGGAATTGGGTAAGGGGCAGAGG - Intergenic
1199370741 X:147044588-147044610 TGGAGCTGGGTAATGGGTAGAGG - Intergenic
1199373674 X:147082643-147082665 TGCAACTGGGCAATGGGCAGAGG + Intergenic
1199806594 X:151306455-151306477 TGGAACTGGGTAATGGGCAGAGG - Intergenic
1200167070 X:154043871-154043893 AGCAACTGCTTAATGGGTAAAGG - Intronic
1200460796 Y:3452218-3452240 TGAAGCTGGGTAATGGGTAGAGG + Intergenic
1200680264 Y:6202243-6202265 TGCAACTGGTTAATGGGCAGAGG + Intergenic
1201162785 Y:11179867-11179889 CGGAACTGGGTAATGGGTAGAGG + Intergenic
1201374079 Y:13296957-13296979 TGCAACTGGGTAATAGGCAGAGG - Intronic
1202282563 Y:23205163-23205185 TGTAAATGGGTAATGGGTAGAGG + Intergenic
1202283328 Y:23213356-23213378 TGTAAATGGGTAATGGGTAGAGG - Intergenic
1202434236 Y:24819548-24819570 TGTAAATGGGTAATGGGTAGAGG + Intergenic
1202435003 Y:24827742-24827764 TGTAAATGGGTAATGGGTAGAGG - Intergenic
1202594080 Y:26518267-26518289 TTCAATGGGGTAATAGCTAAAGG - Intergenic