ID: 992041599

View in Genome Browser
Species Human (GRCh38)
Location 5:72839633-72839655
Sequence CAGACTGCACCGATTAATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992041599 Original CRISPR CAGACTGCACCGATTAATAT GGG (reversed) Intronic
905508031 1:38495700-38495722 CAGATTGCACCCCCTAATATGGG + Intergenic
916565300 1:165970765-165970787 CTGACTGCATAGATTAATTTTGG + Intergenic
924132181 1:240922005-240922027 CACACTGCCTCGATTACTATAGG - Intronic
1072597174 10:96884851-96884873 GAGAGTGCACTGATTAATATGGG - Intronic
1076226459 10:128780279-128780301 CATACTGCAATTATTAATATTGG + Intergenic
1080008983 11:27438629-27438651 CAGATTGCACTCCTTAATATGGG + Intronic
1081240086 11:40694781-40694803 CACACTGCACAAATTGATATAGG + Intronic
1095381730 12:41602752-41602774 GTGACTGCACTGATTATTATAGG + Intergenic
1100674141 12:96847826-96847848 CAGAATGTACCTATTAATAAAGG - Intronic
1108939605 13:55936409-55936431 CAGACTGCACTGTTAAATAGAGG + Intergenic
1139354423 16:66359014-66359036 CAGACTTCACAGGTTAATAAAGG + Intergenic
1151176370 17:72291668-72291690 AAGACTGCATGGATTAATCTTGG - Intergenic
1162288916 19:9763651-9763673 CAGACTGCACCTATAAATAGAGG - Intronic
1166433939 19:42751332-42751354 CAGGCTGCACTGATTTTTATTGG + Intronic
929880042 2:45827807-45827829 CAGAGTCAACTGATTAATATTGG + Intronic
941928256 2:170916783-170916805 CAGACTGCACTGATATTTATTGG - Intergenic
944403220 2:199352409-199352431 CTTACTGCACCAATTCATATAGG - Intronic
1171991635 20:31701006-31701028 CAGACTGCACCTAATAGTCTAGG - Intronic
951796795 3:26548229-26548251 CAGACTGTAGCTATTGATATAGG - Intergenic
956811145 3:72865264-72865286 TGTACTGCACAGATTAATATTGG + Intergenic
962209518 3:133465465-133465487 CAGACTGCATCGAAGAAAATGGG + Intronic
964548001 3:157856510-157856532 CTGACTGCAGGGATTAATGTGGG - Intergenic
965291974 3:166893412-166893434 CAGAATGCAACTGTTAATATGGG - Intergenic
965439747 3:168698577-168698599 CAGACTGCACTGATATTTATTGG + Intergenic
969237820 4:5878619-5878641 CAGACTGCACCTAACGATATGGG + Intronic
983554948 4:169051595-169051617 AAAACTGCACAGATTTATATAGG + Intergenic
989133956 5:38134955-38134977 CAGCCTGCCCTGATTAATCTTGG + Intergenic
992041599 5:72839633-72839655 CAGACTGCACCGATTAATATGGG - Intronic
996271010 5:121604336-121604358 CAGTCTGCACCTTTTAATTTGGG - Intergenic
997761991 5:136458154-136458176 CAGACTGAACCCATTAAAACTGG - Intergenic
1010144412 6:72650294-72650316 CAGAATGTACCTATTTATATTGG - Intronic
1012696975 6:102397340-102397362 CAGACAACTGCGATTAATATGGG + Intergenic
1021640664 7:22733401-22733423 CAGGATGCAAAGATTAATATAGG - Intergenic
1025031695 7:55561975-55561997 CAGACTGAACCGACTACTGTGGG - Intronic
1025928443 7:65977097-65977119 GAGACAGCACCGATTATTACTGG - Intronic
1037112695 8:15183916-15183938 CATACTGCACAGAGTAATAAAGG + Intronic
1040614524 8:49020884-49020906 CAGACTGCCCCTCTTAATCTGGG - Intergenic
1050613977 9:7382593-7382615 CAGAATGCAGCAATGAATATTGG + Intergenic
1050733992 9:8742171-8742193 CAGACTGCACACATTACAATAGG + Intronic
1055472767 9:76630014-76630036 CAGACTGCCCAGGTTAGTATAGG - Intronic
1055489607 9:76791614-76791636 AATACTGCACCAATTATTATTGG + Intronic
1194260919 X:91694548-91694570 CAAACTGCACCCATAAATAATGG - Intergenic
1194532360 X:95067332-95067354 TAGACTGCAATGCTTAATATTGG + Intergenic
1198770235 X:140123265-140123287 CAGACTGCAATGATTGTTATTGG + Intergenic
1200579571 Y:4933350-4933372 CAAACTGCACCCATAAATAATGG - Intergenic