ID: 992042367

View in Genome Browser
Species Human (GRCh38)
Location 5:72848539-72848561
Sequence CGGGGGCTGGGCCGCAGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 10, 3: 58, 4: 422}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992042367 Original CRISPR CGGGGGCTGGGCCGCAGCGC GGG (reversed) Intronic
900098362 1:949693-949715 CTGGAGCTGGGCAGCAGAGCTGG + Intronic
900122540 1:1054952-1054974 GTGGGGCAGGGCCGCAGCTCTGG - Exonic
900192421 1:1357060-1357082 CGGGGGCTGGGGCACAGCCCTGG - Intronic
900207924 1:1439496-1439518 CGTGAGTTGGGCCCCAGCGCTGG + Exonic
900255033 1:1693435-1693457 GGGGGGCGGGGCCGCCGCGCGGG + Intronic
900263776 1:1746701-1746723 GGGGGGCGGGGCCGCCGCGCGGG + Intergenic
900409807 1:2507435-2507457 CGGGGGCTGGGCCTCTGCCCTGG + Intergenic
900513020 1:3069330-3069352 CGGGGCCCGGGCCGCCGGGCCGG + Intronic
900544998 1:3223740-3223762 CGGGGGCTGATCCCCAGCCCTGG - Intronic
900605812 1:3523074-3523096 CGGGGGGGGGGCCCCAGGGCTGG + Intronic
900633959 1:3652682-3652704 CGGGGGCTGGAGCGCAGCGCTGG + Intronic
900971123 1:5992913-5992935 CGGAGGCAGGGACGCAGGGCCGG - Intronic
901055965 1:6448737-6448759 CGGCAGCTGGGCCGCTGCCCCGG + Exonic
901183971 1:7360301-7360323 TGGGGGCTGGGACTCAGCCCTGG + Intronic
901242875 1:7704972-7704994 CGGGGGCGGGGCCGGGGCGTGGG + Intronic
901332811 1:8423873-8423895 CGGGGCCGGGGCCGGGGCGCGGG - Intronic
901433872 1:9234704-9234726 CGGGGGCGGGGCGGGGGCGCCGG - Intergenic
901525935 1:9823613-9823635 CCGGGGCTGGGCCGGGCCGCTGG - Intronic
902478430 1:16699902-16699924 CGGCAGCTGGGCCGCTGCCCCGG - Intergenic
903032891 1:20476308-20476330 CGGGGGCAGGGAGGCCGCGCGGG + Intergenic
903069098 1:20717822-20717844 CAGGGGCGGGGCCGCGGCGGGGG + Exonic
904011399 1:27392459-27392481 AGGGGGCGGGGCCGCAGCCACGG + Intergenic
904128554 1:28259604-28259626 CCTGGGAAGGGCCGCAGCGCAGG - Exonic
904249540 1:29213228-29213250 CGGGGGCTGGCCCGAAGCACTGG + Intronic
904822920 1:33256738-33256760 CGGGGGCCGGGCCGGGGCGCGGG + Intronic
905166175 1:36084462-36084484 CGGGGACTGGCCCGCAGCCTGGG + Intronic
905381114 1:37562279-37562301 GTGGGGCTGGGTCGCAGGGCAGG - Intronic
905656986 1:39691651-39691673 CGGGGGCTGAGCCTCAGGGCAGG - Exonic
905819758 1:40980112-40980134 CGGGGCCTGCGCTGCCGCGCTGG + Intronic
905960076 1:42035856-42035878 CGGGCGGCGGGCGGCAGCGCTGG + Intronic
906214313 1:44030352-44030374 CGGGGGCGGGGCCGTGGGGCGGG - Intronic
907261332 1:53220675-53220697 CCGGGGCCGGGCCGCGGGGCAGG + Intergenic
907513738 1:54980613-54980635 GGCGGGCTGGGCGACAGCGCTGG + Intergenic
907516939 1:54998837-54998859 CCGGGGCTGGGCCCCAGCCAAGG - Intergenic
908355053 1:63320398-63320420 AGGGGCCCGGGGCGCAGCGCTGG - Intergenic
909475240 1:76074677-76074699 CGGGGGCGGGGCCGCGGCTCGGG + Intergenic
912800185 1:112715320-112715342 CGGGGGCGGGGCCGCGGCCGAGG - Exonic
914702889 1:150150186-150150208 CGGGGCCTCGGCGGCACCGCGGG - Exonic
915321254 1:155057599-155057621 CGGGGGCCGGGCATCAGAGCAGG - Intronic
915586906 1:156848890-156848912 CGGGGGCGGGGCCGGAGCGGGGG - Intronic
915937759 1:160098917-160098939 CTGGGGCTGGGCCGAGGCCCGGG - Intronic
916666957 1:166975426-166975448 CGGGGGCTGGATCGCGCCGCCGG + Intronic
918487659 1:185045973-185045995 AGGGGACCGCGCCGCAGCGCCGG - Intronic
919820551 1:201469268-201469290 CGGGGGCGGGGCCGCAGCGGGGG + Intergenic
919926295 1:202193547-202193569 CAGGGCCTTGGCCGCAGGGCTGG - Intergenic
921029705 1:211326772-211326794 CTGGGGCGGGGCCGGGGCGCGGG - Intronic
921167007 1:212514783-212514805 CGGGGGCTGGGAGGCTGCGGGGG - Intergenic
922706930 1:227795049-227795071 GCGGGGCTGGGCCCCAGGGCAGG + Intergenic
922739379 1:228006899-228006921 CGGGGGCGGGGCAGCGCCGCGGG - Intergenic
922751685 1:228073113-228073135 CCGGGCCTGGACCACAGCGCTGG + Intergenic
922751729 1:228073304-228073326 CGGGGGCTTGGCCGCAGTGAGGG - Intergenic
922811253 1:228416695-228416717 CGGGGGCTGGGGGGCGGCGGGGG + Intronic
923711976 1:236395319-236395341 CCGGGGCTGGGACGCAAGGCGGG - Intronic
924624558 1:245688105-245688127 AGGAGCCTGGGCCGCAGCGCCGG + Exonic
1062863717 10:831486-831508 CAGTGCCTGGGCCGCAGAGCCGG + Intronic
1062907527 10:1188951-1188973 GGAGGGCTGGGCCCCAGCGTGGG - Intronic
1064297193 10:14089324-14089346 GGTGGGCTGGGCCCCAGCGGGGG - Intronic
1064380463 10:14837774-14837796 CAGCTGCTGCGCCGCAGCGCGGG + Intronic
1065024526 10:21527285-21527307 CGGGCGCGGGGCCGGCGCGCCGG + Intergenic
1065100373 10:22325586-22325608 CGGGGGCGGGGCCGGCGCGGGGG - Intronic
1065367885 10:24952758-24952780 CAGGGGAGGGGGCGCAGCGCCGG - Intergenic
1067286881 10:44913307-44913329 CGGGAGGTGGGCCTCAGCTCTGG - Intronic
1067669492 10:48306546-48306568 CGGGGGCGGGGCCGCCGCCCGGG - Intergenic
1067769845 10:49115373-49115395 TGGGGGCCGGGCGGCCGCGCCGG - Intronic
1067806281 10:49395562-49395584 CTAGGGCTGGGCGGGAGCGCTGG - Intronic
1070147540 10:73785815-73785837 CGGGGCCTGGGCCGCCGGCCGGG - Exonic
1071997533 10:91162922-91162944 CGGGGGCTGGGCCGGCCCGGCGG - Intergenic
1073403444 10:103277083-103277105 CCGGGGCTGGGGCGGCGCGCTGG - Intergenic
1074085711 10:110207894-110207916 CGGGGGCTGGGGCGCGGCCACGG - Exonic
1075501727 10:122980711-122980733 CGGGGCCTGGGCCGCGGGGCGGG + Intronic
1075699842 10:124462071-124462093 AGGGGGCGGGGCCGCGGCGCAGG + Intronic
1076372370 10:129963879-129963901 CGGCGGCGGGGCCGGACCGCAGG - Intergenic
1076572006 10:131439180-131439202 CATGGGCTGGGCAGCAGCACTGG + Intergenic
1076658169 10:132037812-132037834 AGTTGCCTGGGCCGCAGCGCAGG + Intergenic
1076778615 10:132711567-132711589 CGGGGGCTGGGCGGGGGCTCAGG - Intronic
1076815064 10:132910493-132910515 AGGGAGCTGGGGCGCAGCCCAGG - Intronic
1076850255 10:133088944-133088966 TGGGGGCTAGGCCGCTGCGGGGG + Intronic
1076898444 10:133325476-133325498 CGGGGGCGGGGCTGCAGCGAGGG + Exonic
1076985980 11:236370-236392 CGGAGGCGGGGCCGGGGCGCCGG - Exonic
1077194774 11:1273856-1273878 CGGGGGTTGGGCAGCAGAGAGGG + Intergenic
1077300078 11:1842737-1842759 CGGGGGCAAGGGCACAGCGCAGG - Intergenic
1077384623 11:2263135-2263157 AGAGGGCTGGGCCGGAGGGCTGG - Intergenic
1077476202 11:2791676-2791698 CGGGGGCTTGGCGGCAGCTGCGG + Intronic
1080503790 11:32893208-32893230 GGGGGGCTGCGCAGCGGCGCTGG - Exonic
1080515525 11:33016078-33016100 CGCGGGCTGGGTCCCGGCGCGGG + Intronic
1080802142 11:35618789-35618811 CGGGCGCGGGGCCGCCGCTCCGG - Exonic
1083617920 11:64035650-64035672 GGGAGGCTGCGCCGCCGCGCGGG - Intronic
1083797752 11:65027464-65027486 CGGAGGCTGGGCCGGAGGGGTGG + Exonic
1083900442 11:65640879-65640901 CGGGGGCTGGGCCGCATTGGCGG - Exonic
1084014234 11:66369270-66369292 CTGGGGCTGGGCAGTAGGGCTGG + Intronic
1084611083 11:70203419-70203441 GGAGGGCCGGGCCGCAGCCCCGG + Exonic
1084621177 11:70271036-70271058 TGGGGGCGAGGCCGCGGCGCCGG + Intronic
1084978660 11:72816863-72816885 CAGGGGCAGGGCCCCAGCACAGG - Intronic
1088315022 11:108498436-108498458 CGGGGACTGGGGCCCACCGCGGG + Intergenic
1088764652 11:112963223-112963245 CGGGGGACCGGCCGCAGGGCGGG - Intronic
1089520037 11:119057225-119057247 CGGGGCCGGGCGCGCAGCGCAGG - Intergenic
1089607353 11:119649058-119649080 TGGGAGCTGGGCCACAGTGCTGG + Intronic
1089729596 11:120511927-120511949 CGGGGGCGCGGGGGCAGCGCAGG - Intronic
1090345025 11:126062754-126062776 CCGGGGCTGGGGCGCTGGGCAGG + Intronic
1090661675 11:128886662-128886684 CGTGGGCTGGGCCCTAGTGCTGG - Intergenic
1091386468 12:99164-99186 CGGCGGCTGGGCAGCAGAACTGG - Exonic
1092228447 12:6764156-6764178 TGTGGGCTGGGCCTCAGGGCTGG - Intronic
1092861833 12:12725264-12725286 CGGGGCCGCGGCCGGAGCGCGGG - Intergenic
1095986857 12:48004740-48004762 GGGGGGCAGCGCCGCAGCCCCGG - Intergenic
1096233307 12:49909571-49909593 CCAGGGCTGGGCCCCAGGGCGGG - Intergenic
1096337046 12:50764371-50764393 CGCCGGCGGGGACGCAGCGCGGG + Intronic
1096692206 12:53328249-53328271 CTGGGGGAGGGCCGCAGCACGGG - Exonic
1101493964 12:105236172-105236194 CGGGGGCTGGGCCGGCGGGCAGG - Intronic
1101969029 12:109299863-109299885 CCGGGGCTGGGCTGCCCCGCTGG - Intronic
1102101304 12:110281085-110281107 CGGGGCCTGCGCGGCAGCGTGGG + Intronic
1102853914 12:116277353-116277375 CGGTGGCCGGCCCGCAGCGCCGG - Intergenic
1103698525 12:122835578-122835600 CGGGTGCTGAGCCGCAGGCCGGG + Exonic
1103926836 12:124427878-124427900 AGGGGGCTGGGCCGGAGGACAGG - Intronic
1105000654 12:132687850-132687872 CGGGGCCTGGACGGGAGCGCCGG + Intronic
1105406543 13:20137031-20137053 GGTTGGCTGGGCCGCTGCGCAGG - Intergenic
1105557394 13:21459487-21459509 AGGGGGCGGGGCCGCAGCTCGGG + Intergenic
1107935337 13:45341292-45341314 CGGGGGCGGGGCCACAGCGGGGG + Exonic
1112216218 13:97434001-97434023 CGGGGGCGGGGCTGCGCCGCGGG + Intergenic
1112507652 13:99984855-99984877 AGGGGGCTGGGCCGCGGCGAGGG - Intronic
1112509614 13:99997810-99997832 CTGGGCCTGGGCCGCAGCCGTGG - Intergenic
1113372271 13:109734264-109734286 CAGGGGCTGGGCCAGGGCGCAGG + Intergenic
1113513722 13:110874804-110874826 CGGGGGCGGGGCGCCGGCGCGGG - Intergenic
1113737636 13:112689895-112689917 AGGGGGCAGGGCCGGCGCGCGGG + Intergenic
1113960665 13:114124046-114124068 TGGGGGCTGGGCCGGGGGGCTGG - Intronic
1115755853 14:36525411-36525433 CGCGGGCTTGCCAGCAGCGCTGG + Intergenic
1116876447 14:50116608-50116630 AGGGGGCGGAGCCGCAGGGCGGG - Intergenic
1117183639 14:53217697-53217719 CGGGGGCAGGCCAGCAGTGCTGG + Intergenic
1117978820 14:61322078-61322100 CGGGGCCGGGGCAGCGGCGCCGG + Exonic
1118610163 14:67533432-67533454 CTGGGGCTGCGCCGCGGCGGAGG + Intronic
1119003910 14:70907540-70907562 CGGGGGCCGGGCCGCGGCTCCGG + Exonic
1119726506 14:76924809-76924831 CGGGGGGTGGGCAGCAGAGAGGG - Intergenic
1121137385 14:91510642-91510664 CGGAGGCGAGGCCGAAGCGCCGG - Intergenic
1121368043 14:93332695-93332717 CGGCGGCTTGGCCCCAGCCCCGG + Intronic
1122045659 14:99021349-99021371 GGGGGGCGGGGCCGCAGCTCTGG + Intergenic
1122065973 14:99174797-99174819 CCGGGGCTGGGCAGCGGCGCGGG + Exonic
1122145080 14:99684183-99684205 CGGGGGAGGGCCCGGAGCGCCGG + Intergenic
1122275579 14:100589196-100589218 CTGGGGAAGGGCCGCAGCCCAGG - Intergenic
1122779121 14:104136263-104136285 GGCGGGCGGGGCCGGAGCGCGGG + Intergenic
1122975404 14:105168823-105168845 AGGGGGCGGGGCCGCGCCGCGGG + Exonic
1123002222 14:105301512-105301534 CGGGGCCAGGGCAGCTGCGCTGG + Exonic
1123021063 14:105398250-105398272 CGCGCGCGGGGCCGCAGGGCTGG - Intergenic
1123115179 14:105891275-105891297 CAGGGGCTGGGCTGCTGGGCGGG + Intergenic
1124453871 15:29822551-29822573 AGGGGGCGGGGCCGCGGCGGGGG + Intronic
1127995485 15:64151388-64151410 CGGGGCCCGGGCCTCAGCGCCGG - Intergenic
1127995783 15:64152444-64152466 CGGGGGCTGACCGGCTGCGCAGG - Intronic
1128028721 15:64460971-64460993 GGGGGGCTGGGGCGGAGCGAGGG + Intronic
1128056476 15:64703243-64703265 CGGGGGCGGGGCGGCGGCGGCGG - Exonic
1128455119 15:67827692-67827714 CGGGGGCCGGGACCCGGCGCTGG + Exonic
1128967023 15:72069810-72069832 GGGGGGGTGGGGCGCAGGGCCGG + Intronic
1128999355 15:72319859-72319881 CGGGGACATGGCCGCGGCGCCGG - Exonic
1130247141 15:82262498-82262520 CAGGGGCTGGGGCCGAGCGCGGG - Intronic
1130335298 15:82952728-82952750 CGGGGGCTGGGCGGCCGCGCTGG + Exonic
1130453488 15:84080420-84080442 CAGGGGCTGGGGCCGAGCGCGGG + Intergenic
1131888652 15:96948028-96948050 CGAGAGCCGGGCAGCAGCGCGGG - Intergenic
1132512843 16:352725-352747 CGGGGGCGGGGCCGGGGCGCGGG + Intergenic
1132553819 16:564213-564235 CGGGGCCAGGGCCCCAGCCCTGG - Exonic
1132588102 16:715003-715025 CGGGGGCGGGGCCGGAGCTCGGG - Intronic
1132672973 16:1109287-1109309 CGGGGGCTGGGGGGCGGTGCAGG + Intergenic
1132983062 16:2749161-2749183 CTGAGGCTGGTCCTCAGCGCAGG - Intergenic
1132987860 16:2777323-2777345 CGGGGGAAGGGACGCGGCGCGGG - Intergenic
1133022788 16:2974198-2974220 CCGGGGCTGGGGAGCAGGGCAGG + Intronic
1133207191 16:4240736-4240758 CTGGGGCTGGGGGGCAGCACAGG + Intronic
1133219925 16:4315652-4315674 CGGGGGCGGGGCCGCGGGGGGGG + Intronic
1133286552 16:4693472-4693494 CGGAGGCGGGGCCGCCGCCCAGG + Intergenic
1133460521 16:5983138-5983160 GGGGGGCAGGGACGCAGAGCTGG - Intergenic
1134024648 16:10944650-10944672 CGGGCGCTGGGCCGCTCTGCTGG + Exonic
1135397370 16:22141576-22141598 CGTTGGCTGGGCCGCAGCTGAGG - Exonic
1135407014 16:22206141-22206163 CTGGGGCTGGGAGCCAGCGCCGG + Intergenic
1136414682 16:30096042-30096064 CGCGGGCTGGGCAGGGGCGCGGG + Exonic
1136579402 16:31142667-31142689 GGCCGTCTGGGCCGCAGCGCGGG - Intronic
1136858654 16:33681174-33681196 AGGGGGCGAGGGCGCAGCGCCGG + Intergenic
1137426397 16:48384883-48384905 CGGGGGCCGGGCCGCCGCCGAGG + Intronic
1137979128 16:53055047-53055069 CGGGGACTGGAGGGCAGCGCCGG + Exonic
1138360732 16:56425361-56425383 CAGAGGCCCGGCCGCAGCGCAGG - Exonic
1138480734 16:57301403-57301425 AGGGGGCTGGGCCGCTGACCTGG + Intergenic
1139511603 16:67431196-67431218 CGGGGGCCGGGCCGGGGAGCGGG - Exonic
1141784922 16:86193188-86193210 CGGAGGCTGGGCAGCACAGCTGG - Intergenic
1141958949 16:87392052-87392074 TGTGGGCTGGGCCGCACCCCGGG - Exonic
1141987104 16:87587251-87587273 CGGGGGAAGGGGCGCAGGGCGGG + Intergenic
1142049938 16:87951622-87951644 CGGCGGCGGGGCTGCGGCGCGGG - Intronic
1142106204 16:88304248-88304270 GGGCGGCCGGGCTGCAGCGCTGG - Intergenic
1142135396 16:88449708-88449730 CCGGGGCTGGGCAGCAGCTGTGG - Intergenic
1142136178 16:88453025-88453047 CAGGGGCGGGGCCGCAGCGCTGG + Intergenic
1142136210 16:88453137-88453159 CGGGGGCGTGGCCGCGGCGCTGG + Intergenic
1142136233 16:88453197-88453219 ACGGGGCGGGGCCGGAGCGCCGG + Intergenic
1142143991 16:88485108-88485130 CGGGGACTGGGCCCCTGGGCGGG + Intronic
1142154956 16:88528644-88528666 CGGGGGGTGAGCGGCAGCCCTGG + Intronic
1142727959 17:1830139-1830161 CGGGGGCTGGGCCGGCGGTCCGG + Intronic
1142762862 17:2051653-2051675 GGGGGCCTGGGGCGCAGCGAGGG + Intergenic
1143174910 17:4950041-4950063 TGGGGGCTGGGAGGCCGCGCGGG + Intronic
1143750043 17:9021462-9021484 GGGGGGCGGGGCCGCCGGGCGGG - Intergenic
1144672871 17:17142774-17142796 CTGGGGCTGGGCAGCACCTCAGG + Intronic
1145163142 17:20589226-20589248 CGGGGGGTAGGGCGCAGCCCGGG - Intergenic
1145750724 17:27353648-27353670 AGGAGGCTGGGGCGCAGGGCGGG - Intergenic
1145978867 17:28999702-28999724 TGGGGGCTGGGCCTCAGTGGAGG + Intronic
1146382595 17:32341945-32341967 CGGGGGCGGGGCCGCAGGGGCGG + Intronic
1147133826 17:38424083-38424105 TGGGGGCTGGGGCGCAGGGAGGG + Intergenic
1147179509 17:38675111-38675133 CGGCGGCTGGGAGGGAGCGCGGG + Exonic
1147311599 17:39599111-39599133 CCGAGGCTGGGGCGCGGCGCAGG - Intergenic
1147430327 17:40366878-40366900 CGGGGGCTGGGCCCCTGAGCTGG - Intergenic
1147994584 17:44353890-44353912 CGGGGGCGGGGCCGCAGCCGCGG - Exonic
1148386535 17:47238454-47238476 AGGGGCCTGGGGCGCAGAGCTGG - Intergenic
1148684762 17:49495242-49495264 CGGAGGCGGGGCCGCAGCACTGG + Intergenic
1148852506 17:50561740-50561762 AGGGGGACGGGCCGCACCGCCGG + Intronic
1149914928 17:60600227-60600249 CGAGAGCTGGGCCGGAGCGCCGG - Exonic
1150624895 17:66835321-66835343 CCGGTGCTGGGCCGCGGCGCCGG + Intronic
1151497357 17:74466792-74466814 GAGGGGCAGGGCCGCAGGGCAGG + Intronic
1152245600 17:79183192-79183214 CGGGGCGTGGGCGGCAGCGCGGG + Intronic
1152284475 17:79404244-79404266 CGTGGGCAGGGCCACAGCGGTGG + Intronic
1152732209 17:81977870-81977892 AGGGGGCGGGGCCGCCGCTCAGG - Intronic
1152749368 17:82055591-82055613 CGGGAGCTGTTCCTCAGCGCTGG - Intronic
1152917830 17:83051272-83051294 CGGGGGCGGGGCAGGTGCGCAGG + Intronic
1155152796 18:23135884-23135906 CGGCGGCTGGGCCGGCGCGGCGG - Exonic
1157848920 18:51030024-51030046 CTGGGCCTGGGCCTCAGCGCGGG - Intronic
1158954763 18:62526838-62526860 CGGGGGCGGGGCCGGCGCGCCGG - Intronic
1159586733 18:70289233-70289255 CGGGCGCGGGGCTGCAGCGACGG + Intronic
1159586832 18:70289520-70289542 CGAGGCCTGGGCAGCGGCGCGGG + Intronic
1160156953 18:76441725-76441747 CGGGGCCTGGGACGAGGCGCTGG - Exonic
1160763555 19:797541-797563 CGGGGGCAGGGCTGCGGCGCGGG - Intronic
1160768887 19:821716-821738 CGCGTGCTGGGCCGGGGCGCGGG - Intronic
1160983540 19:1827407-1827429 GTGGGGCTCGGCCGCCGCGCTGG + Exonic
1161060781 19:2213758-2213780 CAGGGGCTGGGCTGCAGGGGTGG + Intronic
1161087197 19:2340644-2340666 CGGGCGAAGGGGCGCAGCGCAGG + Intronic
1161388106 19:4007673-4007695 CGCGGGCGGGGCCGCCGCCCGGG - Exonic
1162033246 19:7926172-7926194 CGGGGGCGGGGCCGCCGCGGGGG + Intergenic
1162111980 19:8404364-8404386 CGGGGACGGGGCAACAGCGCAGG - Exonic
1162743074 19:12784012-12784034 CGGGGGTGGGGCTGCAGCGTGGG - Intronic
1162743833 19:12788509-12788531 TGGGGGCAGGGGCGCAGGGCAGG - Intronic
1162940396 19:14005903-14005925 CGGGGGCCGGGCCGCGGGGACGG + Intronic
1163271989 19:16259989-16260011 AGGGGGCAGGACGGCAGCGCGGG + Intergenic
1163282151 19:16324759-16324781 CGGGGGCCGGGCCAAAGCGGCGG - Intergenic
1165177243 19:33939264-33939286 GGAGGGCTGGGCTGCAGCCCTGG + Intergenic
1165227463 19:34365107-34365129 CGGGGGCGGGGCCGGGGCTCAGG + Intronic
1165349737 19:35269189-35269211 CGGGGCCGGGGCCGGGGCGCGGG - Intronic
1166094448 19:40530439-40530461 CGGGCGCGCGGCCGCCGCGCGGG + Intronic
1166125722 19:40714531-40714553 TGGGGCCTGGGCCCCACCGCTGG - Exonic
1166330689 19:42076447-42076469 CGGGGGCCGGGCTGGAGCGGCGG + Intronic
1166541360 19:43607917-43607939 CGGGGGCTGGGCTGCACGGGGGG + Exonic
1166745790 19:45141284-45141306 CGGGGGCTCAGCCTCAGCTCTGG - Intronic
1166856908 19:45786737-45786759 CTGGGGCGGGGCCGAGGCGCAGG + Exonic
1166872316 19:45878357-45878379 GAGGGGCTGGGCCACAGCCCTGG - Intergenic
1167048486 19:47065436-47065458 CCGGGGCTGGGCTGCAGTGCAGG + Exonic
1167074271 19:47239545-47239567 TGGGGGCTGGGCGGGGGCGCGGG + Intergenic
1167079020 19:47266602-47266624 GGGGGGCAGGGCCGCCGAGCTGG + Exonic
1167080686 19:47274677-47274699 CGGGGGCGGGGCTGGAGCGAGGG + Exonic
1167466955 19:49655138-49655160 CAAGGGGTGGGCTGCAGCGCGGG - Intronic
1167515926 19:49923174-49923196 CGGGGGCTGGGAGACAGCACAGG - Intronic
1202712449 1_KI270714v1_random:25733-25755 CGGCAGCTGGGCCGCTGCCCCGG - Intergenic
925119966 2:1410673-1410695 CCGGGACTGGACCGCAGGGCTGG + Intronic
925233251 2:2254395-2254417 TGGGGGCTGGGCTGCACCTCAGG + Intronic
927156545 2:20224450-20224472 CGGGGGCCCGGCCGCCGCGGTGG + Intronic
927168600 2:20350375-20350397 CGGGGGAGGGGGCGCCGCGCCGG - Intronic
927787306 2:25982585-25982607 AGGGGGCGGGGCCGCGGGGCGGG + Intronic
927935324 2:27072626-27072648 CGGGGGCTGGGCTGTTGCTCTGG + Intergenic
929452662 2:42047754-42047776 CGCGGGCTGGGCGGGACCGCGGG + Intergenic
929775602 2:44929146-44929168 CAGGGGCTGGGCAGCCGCGCAGG + Intergenic
929789763 2:45014004-45014026 CGCGGGCGGGGACGCAGGGCCGG - Intergenic
929857568 2:45650109-45650131 GGAGGGCAGGGCCGGAGCGCTGG - Intergenic
930011522 2:46941405-46941427 CGGGGCCCGGGCGGCAGCGGGGG - Exonic
930700678 2:54456263-54456285 CGGGGGCTGGGCGGGAGCGCGGG - Exonic
931052309 2:58428511-58428533 CGGGGGCGGGGAGGCAGCGGGGG - Intergenic
931516315 2:63052348-63052370 CTGGGGCAGGGGCGCAGCCCTGG + Intronic
932294471 2:70612889-70612911 CCAGGGCTGGGCAGCAGCTCTGG + Intronic
933741471 2:85538000-85538022 CTGGGGCTGGGCCTCGGTGCAGG - Intergenic
935545573 2:104396320-104396342 AGGGGGCTGGGCCTCAGAGAGGG + Intergenic
936534707 2:113303074-113303096 GAGGGGCTGGGACGCAGCGTAGG + Intergenic
938174092 2:129108218-129108240 TGGGAGCTAGGCCACAGCGCGGG + Intergenic
941065162 2:160893626-160893648 TGGGGGCTGGGAGGAAGCGCAGG + Intergenic
943369962 2:187003429-187003451 CGGCAGCATGGCCGCAGCGCGGG - Intergenic
943443297 2:187951889-187951911 CGCGGGCGGGGCAGCAGTGCTGG - Intergenic
944011880 2:194983376-194983398 CAGGGGCTGGGCAGCTGTGCTGG - Intergenic
944413528 2:199463336-199463358 TGGGGGCGGGGACGCAGCGGCGG - Intronic
945245256 2:207711710-207711732 CCGGGGCCGGGCCGCGGGGCGGG + Intronic
1168757182 20:325801-325823 CGGGGGCCGGGCCGAGCCGCGGG + Exonic
1170629938 20:18057501-18057523 CGGGGGCCGGGCCTGGGCGCTGG - Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1172272462 20:33662479-33662501 CGGGGGATGGGGAGCAGGGCTGG + Intronic
1172587019 20:36092397-36092419 CGGCGGCGGGTCCCCAGCGCCGG + Intronic
1174179569 20:48666252-48666274 CGGGGGCTGGGCTGCAGGTGGGG + Intronic
1174736710 20:52972190-52972212 AGGGGCCTGGGCCGGCGCGCCGG + Intergenic
1175108228 20:56629219-56629241 CGGCGCCTGGGCCTCCGCGCCGG + Intergenic
1175307551 20:57987349-57987371 TGGGGGCTGGGCCACAGGTCAGG - Intergenic
1175394501 20:58649643-58649665 AGGGGACTGGGTCGCCGCGCGGG - Intergenic
1175447267 20:59031979-59032001 TGGGTGCTGGGCCGCACCGTCGG + Intronic
1175847103 20:62064995-62065017 CGGGGGCGGGGCGGCGGCGGGGG + Exonic
1175910482 20:62403001-62403023 CTGGGGCTGGGCTGCAGCTGTGG - Intronic
1175939907 20:62533083-62533105 CCGGGGCTGGGCTCCAGGGCTGG + Intergenic
1175952609 20:62591362-62591384 CGGGGGCTGGGGGGAAGCGCTGG + Intergenic
1175997105 20:62816888-62816910 GGCGGGCTGGGCGGCGGCGCGGG + Intronic
1176077349 20:63254483-63254505 CGGGGGCGGGGGCCGAGCGCGGG - Exonic
1176156941 20:63626810-63626832 CGGGGGAGGGGCGGCCGCGCGGG - Intronic
1176221081 20:63969675-63969697 CGGGGGCTCGGGCGCGGCGGGGG + Intronic
1176221217 20:63970039-63970061 CGGGGGCGGGGGCCCGGCGCTGG + Intronic
1177431691 21:20998271-20998293 CGGGGGCGGGGGCGCGGCGAGGG - Intergenic
1178707949 21:34889898-34889920 CGGGGACTGGGTTGCAGCCCCGG - Intronic
1179028563 21:37700646-37700668 CAGGGGCTTGGCCGCTGCCCTGG - Intronic
1179972879 21:44845988-44846010 CGTGTCCTGGGCCGGAGCGCCGG + Intergenic
1180053900 21:45347236-45347258 CGCGGGCTGGGCAGCGGCACAGG + Intergenic
1180091333 21:45535118-45535140 CGGGGCATGGGCCGCAGGTCAGG + Intronic
1180612284 22:17105769-17105791 CTGGGGCTGGGGAGCAGGGCTGG + Intronic
1180843673 22:18970524-18970546 CCGGGGCTGGGCCGGAGCGGCGG + Intergenic
1180914861 22:19479038-19479060 CGGGGGCTGGGCCTTGGCCCGGG - Intronic
1181029554 22:20143209-20143231 CGGGGGCGGGGGCCCAGCACGGG - Exonic
1181050889 22:20237726-20237748 CAGGGGCTGGGCTGCAGGGCAGG + Intergenic
1181057803 22:20268180-20268202 CCGGGGCCGGGCCGTAGCGGCGG - Exonic
1181256701 22:21567646-21567668 CGGGGGAGGGGCCGCGGGGCGGG - Intronic
1181510778 22:23387912-23387934 CTGGAGCCGGGCTGCAGCGCAGG - Intergenic
1181532119 22:23522728-23522750 CGGGGGCCGGGCTGGGGCGCGGG + Intergenic
1181570632 22:23766246-23766268 CAGGGGCTGGGGGGCAGCGGGGG + Exonic
1182363510 22:29762383-29762405 CAGGAGCTGGGCCGCACAGCAGG + Intronic
1182547551 22:31084871-31084893 CGGGGGCCGGGCCGGCGCGCGGG - Intronic
1183702368 22:39457646-39457668 CGGGGAGTGGGCCGCGGAGCCGG - Intronic
1183702519 22:39458029-39458051 CGGGGGCTGGGCGGGTGCGGGGG + Intronic
1183713652 22:39521050-39521072 CGGCGGCAGGGCGGCGGCGCGGG + Exonic
1184046628 22:41976478-41976500 CGGGGGCTGGGGTGTTGCGCGGG - Intronic
1184184678 22:42856910-42856932 CGGGCGGGAGGCCGCAGCGCGGG - Intronic
1184328703 22:43812051-43812073 CTGGGGGTGGGCAGCAGCGCCGG + Intronic
1184457841 22:44621620-44621642 CGGAGACTGGGGCGCAGAGCAGG - Intergenic
1184512697 22:44942694-44942716 CGTGCGCTGGGCCTCAGCTCAGG - Intronic
1184513703 22:44947430-44947452 AGGGGGCTGGGCCCTGGCGCTGG - Intronic
1185299533 22:50072292-50072314 TGGGGGCTGGGCTGCAGGCCTGG - Intronic
1185313788 22:50170355-50170377 CGGGGGCCGGGCTGCGGCGGAGG + Intergenic
1185337612 22:50277766-50277788 CCGGGGCTGGGCCGCGGGGTGGG + Intronic
1185337630 22:50277817-50277839 CCGGGGCTGGGCCGCGGGGTGGG + Intronic
1185388515 22:50547251-50547273 CTGGGGCTGGGCCAAAGCTCCGG - Intergenic
950153841 3:10708040-10708062 CGGCGGCGGGGCCGCGGGGCAGG - Intergenic
950612864 3:14137346-14137368 CGTGAGCTGGGCCTCAGCCCTGG - Intronic
950710582 3:14810644-14810666 CCGGGGCGGGGCCGCCGGGCGGG - Intergenic
952451775 3:33440106-33440128 CGGGGGCTGGGCGGCGGCGCCGG - Exonic
953385239 3:42502519-42502541 TGGAGGCGGGGCCGCCGCGCAGG - Intronic
953748953 3:45595235-45595257 CGGGGGCTGCCCAGCAGCGAGGG - Exonic
954366877 3:50151077-50151099 TGGGGGCTGGGCCAGAGAGCAGG + Intergenic
954385087 3:50239878-50239900 CAGGGGCTGCTCCGCAGCCCTGG + Intronic
954409735 3:50365238-50365260 CGGGGGCGGGGCCGCAGGATGGG - Intronic
954613622 3:51958762-51958784 CGCGGGCTGGGCGGCAGTGGGGG - Intronic
954714385 3:52519860-52519882 AGGGGGCTGTGCCACAGAGCAGG - Intronic
958470202 3:94507628-94507650 CCGCGGCAGAGCCGCAGCGCCGG + Intergenic
961182388 3:124887058-124887080 CGGGGCTGGGGCCGGAGCGCGGG + Exonic
961340290 3:126213000-126213022 GAGGGGCTGGGCCCCACCGCCGG + Intergenic
961532400 3:127547583-127547605 CCGGGGCTGGGCAGCAGGGCAGG + Intergenic
961551560 3:127672872-127672894 CAGGGGCGGGGCCGCGGGGCGGG + Intergenic
961780075 3:129316039-129316061 CTGGGGCCGGGCGGCAGGGCTGG + Exonic
962793885 3:138834632-138834654 GGGCGGCTGGGTCGCGGCGCCGG - Intronic
963697881 3:148584711-148584733 CAGGGGCTGGGGTGCAGTGCTGG + Intergenic
968372810 4:11224-11246 CCGGGGCGGGGGCGCGGCGCAGG + Intergenic
968372819 4:11261-11283 CCGGGGCAGGGGCGCGGCGCAGG + Intergenic
968450646 4:674574-674596 CGGGGCCTCGGCAGCAGCGCGGG - Intronic
968534378 4:1113894-1113916 CGGGAGCTGGGCCGGAGGCCAGG + Intergenic
968572132 4:1347347-1347369 CGGCGGCGGGGCCGGAGGGCGGG + Exonic
968616938 4:1581288-1581310 CGGGGCCTGGGCCGCAGGCGGGG - Intergenic
968653383 4:1768659-1768681 CGGGTCCTGGGCGGCAGCGAGGG - Intergenic
968735278 4:2291904-2291926 AGGGGGCCGGGCTGCAGGGCAGG + Intronic
969094686 4:4723465-4723487 CAGGAGCTGGGCTGCAGAGCAGG - Intergenic
969235813 4:5864554-5864576 CAGGTGCTGGGCCCCAGGGCGGG + Intronic
969392417 4:6900670-6900692 CGGGGGCTGGGGTTCAGGGCAGG - Intergenic
972321639 4:37977606-37977628 CCGGGGCTGGGCCGGGCCGCTGG + Intronic
983547580 4:168979462-168979484 CGGGGGCTGGGTGGCTGTGCTGG - Intronic
984952870 4:185019705-185019727 CAGGCGCTGGGCCGCTGCGAGGG + Exonic
985462576 4:190121306-190121328 CCGGGGCGGGGGCGCGGCGCAGG - Intergenic
985462586 4:190121343-190121365 CCGGGGCGGGGGCGCGGCGCAGG - Intergenic
985556171 5:559015-559037 CGGAGGATGGGCCGCCGCCCGGG + Intergenic
985713949 5:1445541-1445563 CGGGGGCGGGGGCGCGGCCCGGG - Intergenic
985780555 5:1868684-1868706 CAGGGGCTGTGCCACACCGCAGG + Intergenic
985894982 5:2743521-2743543 CGGGCGCCGGGCCGCGGAGCCGG + Intergenic
986733286 5:10650150-10650172 CCGGGGCGGGGCCGCAGGGCTGG + Exonic
988486039 5:31668934-31668956 CTGGGGCTGGACCTCAGGGCTGG + Intronic
989637987 5:43556776-43556798 CGGGGCCTGGGCCGCGGAGGGGG - Exonic
990165445 5:52989142-52989164 CCGGGGCTGGGCCGCTGTACGGG + Intergenic
992042367 5:72848539-72848561 CGGGGGCTGGGCCGCAGCGCGGG - Intronic
992052813 5:72956378-72956400 CCGGGGCTGGGACAAAGCGCCGG + Intronic
994175123 5:96702728-96702750 CCGGGGCGGGGCCGCCGGGCAGG + Intronic
994366966 5:98928303-98928325 CCGGGGCAGGGCCGCCGGGCCGG + Intronic
996393440 5:122988222-122988244 CTGGGGCTGGGCAGAAGCTCAGG - Intronic
996404879 5:123095051-123095073 CAGGAGCTGGGCCGCCCCGCAGG + Intronic
997228751 5:132228151-132228173 CAGGGGCTGGGCAGGAGGGCGGG - Intronic
998041777 5:138955077-138955099 CCAGGGGTGGGCCGCAGCTCTGG - Intronic
998166698 5:139848403-139848425 CGGGGCCCGGACCGCGGCGCGGG - Exonic
998461745 5:142314886-142314908 CCGGGGCGGGGCCCCAGAGCTGG - Exonic
1000071356 5:157743796-157743818 CGCGGGCTGGGCGGGCGCGCGGG - Exonic
1001476563 5:172054857-172054879 CTGGGGCTGGGTCTCAGCTCAGG - Intronic
1001529998 5:172454702-172454724 CCGGTGCTGAGCCGCCGCGCCGG + Intergenic
1001639436 5:173234633-173234655 CGAGGGCTGGGCTGCGGCGGGGG - Intronic
1002029384 5:176416594-176416616 CGGGGGCGGGGCCGCAGGGCCGG + Intergenic
1002445690 5:179288546-179288568 CGGGGGCAGGGCCCCAGCACTGG + Intronic
1005832394 6:29681148-29681170 CCGGGGTGGGGCCGCGGCGCCGG - Intergenic
1006117136 6:31781406-31781428 CGGGGTCTGCGCTGCAGCACAGG + Intronic
1006297434 6:33176160-33176182 CGGGAGCTGGACGGCAGTGCGGG + Intronic
1006580222 6:35072815-35072837 CAGGGGCTGTGCCCCAGCCCAGG + Intronic
1006725505 6:36196807-36196829 CCGGGCCGGGGCCCCAGCGCGGG + Exonic
1006948440 6:37801187-37801209 AGGGGGCTGGGCCCCCGTGCTGG - Intergenic
1007444532 6:41895056-41895078 AGGGGGCGGGACCGCGGCGCCGG - Intronic
1007735580 6:43980356-43980378 AGGGGGCTGGGGTGCAGCCCAGG - Intergenic
1007784142 6:44270620-44270642 CGGGGGGTGGGGAGCAGCGAGGG + Exonic
1010703301 6:79077766-79077788 CGGCGGCGGGGCCGCGGCCCGGG - Intronic
1011128729 6:84033683-84033705 CCGGAGCAGGGCTGCAGCGCGGG - Intergenic
1011734441 6:90297035-90297057 CGGGGGCTGGGGCGGGGGGCGGG + Intergenic
1014221547 6:118803448-118803470 GGGGGGGTGGGCGGCAGCGGAGG + Intergenic
1015965492 6:138692767-138692789 CGGGGGCGGGCCGGCGGCGCGGG + Intergenic
1016386716 6:143536961-143536983 CGGCGGCGGGGCCGGAGCACCGG - Intronic
1017163781 6:151390289-151390311 CGGGGCCGGGGGCGCGGCGCCGG + Intronic
1017719886 6:157236630-157236652 CGGGGCCAGGGACGCAGCGGGGG + Intergenic
1018036692 6:159888183-159888205 AGGGGGCTGGGCTGCACCGACGG - Intergenic
1018433126 6:163738511-163738533 TGGGGGCAGGGCCACAGCTCGGG + Intergenic
1018434574 6:163749023-163749045 GGGGGGCTGGGCGGCCTCGCAGG + Intergenic
1018814742 6:167322179-167322201 CTGGGGATGGCCCGCAGCTCCGG - Intergenic
1019164288 6:170088004-170088026 CGTGGGGTGGGCGGCAGCACAGG + Intergenic
1019331628 7:463315-463337 CGGAGGCTGGGTCCCAGCGCCGG - Intergenic
1019331849 7:464173-464195 CGGAGGCTGGGTCCCAGCGCTGG + Intergenic
1019343180 7:518059-518081 CCGCGGCTGGGCCGGAGCCCGGG - Intronic
1019344282 7:521836-521858 CGGGGGCTGGGGCGGGGCGTGGG + Intergenic
1019404541 7:876815-876837 CGGGCGCTGGGCTGCGGCGAGGG - Intronic
1019437229 7:1028439-1028461 CGGGGACTGGACCTCGGCGCGGG + Intronic
1019453504 7:1112372-1112394 TGGAGGCCGGGCCGCAGGGCAGG - Intronic
1019593243 7:1846208-1846230 CAGGGGCTGGTCAGCAGCACAGG + Intronic
1019774721 7:2905791-2905813 CGGGGGCCTGGCCTCAGGGCTGG + Intergenic
1020125430 7:5530422-5530444 CGCCGTCTGGGCCGCAGCGGGGG - Intronic
1020130229 7:5555362-5555384 GGGGGGCTGGGCTGCACCCCCGG - Intronic
1021206425 7:17786645-17786667 GGGGGTCAGGGCCGCAGCCCTGG + Intergenic
1022471604 7:30684966-30684988 ATGGGGCTGGCCTGCAGCGCTGG - Intronic
1022942537 7:35254204-35254226 CGGGGGCGGGGCCGCGGGCCGGG + Intergenic
1023638799 7:42237919-42237941 CGGGGGCTGGGGGGGAGCCCGGG + Intergenic
1026840385 7:73667635-73667657 CCGGTGCTGGGGCGCAGAGCAGG + Intergenic
1028684188 7:93574770-93574792 CGGGGGTGGGGCGGGAGCGCAGG - Intergenic
1029110537 7:98211333-98211355 CGGGCGCTGGGCAGCAGTGGCGG - Intergenic
1029139722 7:98401137-98401159 CGGGGGCGGGGCCGCAGGGCCGG + Intergenic
1029278116 7:99419656-99419678 TGGGGCCTGGGCCGCCCCGCCGG - Exonic
1029813986 7:103075243-103075265 CCGCGGCAGAGCCGCAGCGCCGG - Exonic
1033253286 7:139778049-139778071 CGGGGGCGGGGGCGGGGCGCGGG + Intronic
1033300124 7:140177521-140177543 CCGGTGCGGGGCCGCAGCTCCGG - Intergenic
1033597704 7:142868604-142868626 CCTGGGCCGGGCCGCAGTGCTGG + Exonic
1033610725 7:142961296-142961318 CTGGGCCTGGGCCCCAGGGCTGG + Intronic
1034188317 7:149195803-149195825 CGCGGGCTGGGCCGCGGGACCGG + Intronic
1034263648 7:149771816-149771838 CGGGGGCGGAGCCGAGGCGCCGG - Intronic
1035023051 7:155809941-155809963 CAGGGGCCGGGGCGCATCGCGGG - Intronic
1035717184 8:1763612-1763634 CGGGGGGCGGGGCGCGGCGCGGG - Intronic
1037876588 8:22551732-22551754 CCGGGGCTGGGCCGGAGAGGAGG - Exonic
1038575675 8:28701728-28701750 CCGGGGCTGGCCCCGAGCGCTGG + Intronic
1038633033 8:29263219-29263241 CGTGGGCGGGGCCGCAGCGAAGG + Intergenic
1039617725 8:38969670-38969692 CGGGAGCTGGGCAGCACCCCAGG - Exonic
1040423377 8:47260853-47260875 CGGGCGCTCGGGCGCAGGGCGGG - Exonic
1041552837 8:59119801-59119823 CGGGGGCGGGGCTGCGGGGCGGG - Intergenic
1043296129 8:78665984-78666006 TGGGGGCGGGGCCGCGGCGGAGG - Intergenic
1047892795 8:129331133-129331155 GGGGGGCGGGGCTGCAGGGCCGG + Intergenic
1048553231 8:135453406-135453428 CTGGGGCTGGGCAGCTGAGCAGG + Intergenic
1049198125 8:141326478-141326500 CGGGGGTGGGGCGGCAGGGCTGG + Intergenic
1049235022 8:141508095-141508117 CGGGGGCCGGGTCGCGGAGCAGG - Intergenic
1049252966 8:141598982-141599004 CAGGGGCTGGGCGGGAGAGCAGG - Intergenic
1049637060 8:143694754-143694776 CGGGGGCTGCGCCCCGGCGCCGG + Exonic
1049653785 8:143788991-143789013 TGGAGGCTGAGCAGCAGCGCCGG + Intergenic
1049762243 8:144336799-144336821 CGGGGGTTTGGCCGCCGGGCAGG + Intergenic
1049766634 8:144358202-144358224 CTTGGGCTTGGCCGCGGCGCTGG + Exonic
1049790411 8:144469793-144469815 AGGGGGCTGGGAAGCAGGGCAGG + Intronic
1053157652 9:35791861-35791883 CGAGGCCTGGGCCGGAGGGCAGG - Intergenic
1053435155 9:38069281-38069303 GGGGGGCGGGGCGGCGGCGCGGG - Intergenic
1053435197 9:38069377-38069399 CGGGGCTTGGGCCGCGGCCCGGG - Intergenic
1053643123 9:40106765-40106787 CGGCGGCTGCGGCGCAGCCCGGG + Intergenic
1053763027 9:41358724-41358746 CGGCGGCTGCGGCGCAGCCCCGG - Intergenic
1054541633 9:66269838-66269860 CGGCGGCTGCGGCGCAGCCCCGG - Intergenic
1057389817 9:94633597-94633619 CGGCGGCTGGACCGCAGTTCAGG - Intronic
1057432232 9:95004943-95004965 CGGGGCCTGGGCGGCGGCGCGGG - Intronic
1057436829 9:95048451-95048473 CGGGGCCTGGGGCGCAGGGGCGG + Intronic
1057631138 9:96719942-96719964 CCCGGGCTGGGCTCCAGCGCTGG - Intergenic
1057772812 9:97983320-97983342 AGGGGGCTGGAGCGCAGCGCTGG - Intergenic
1057881531 9:98796305-98796327 CGGGCCCGGGGCCGCAGCGGCGG - Exonic
1057903651 9:98967898-98967920 AGGGTGCTGGGCCTCAGCCCAGG + Intronic
1060182782 9:121545729-121545751 GAGGGGCTGAGGCGCAGCGCTGG + Intergenic
1060283032 9:122226792-122226814 CGGGGCGTGGGACGCAGCGCAGG - Intronic
1061003854 9:127917228-127917250 CGGGGGCGGGGCTTCAGAGCCGG + Intergenic
1061065571 9:128275714-128275736 CGGGGGCTGGGCGGCTGAGGGGG + Intronic
1061127993 9:128689023-128689045 CGGGGGAGGGGACGCGGCGCGGG + Intronic
1061293667 9:129666044-129666066 CGGGGCCAGGGCCGAGGCGCGGG + Exonic
1061293715 9:129666169-129666191 CGGGGCCGGGGCCGGGGCGCGGG + Intronic
1061438090 9:130579448-130579470 TGGGGGCGGGACGGCAGCGCCGG - Intronic
1061539868 9:131272421-131272443 AGGGGGCTGGGCAGCATCCCTGG - Intronic
1061543638 9:131291174-131291196 CGGGGGCTGGGCATCACCTCTGG - Intronic
1062341422 9:136095322-136095344 CGGGGGCGGGGCGGCGGCGGGGG + Intergenic
1062352200 9:136144694-136144716 GGTGGGCTGGGCTGCAGAGCTGG - Intergenic
1062364727 9:136203214-136203236 GGGGGGCGGGGCCGCGGGGCGGG + Intronic
1062397379 9:136357941-136357963 CCGGGGCTGGTCAGCAGCGGTGG - Intronic
1062574497 9:137200062-137200084 CGGGGTCTGCACCGCGGCGCGGG - Exonic
1186512804 X:10143163-10143185 CGGGGCCTGCCCAGCAGCGCTGG - Exonic
1186973330 X:14873248-14873270 CGGGGGCGGGACCGCAGTGCGGG + Intergenic
1188482973 X:30653351-30653373 CGGGGCCTGGGCCGGAGGGGCGG + Exonic
1189332881 X:40153939-40153961 AGGGGGCGGGGACGCAGCCCCGG + Intronic
1190265696 X:48826384-48826406 CAGGGGCAGGGGCGCGGCGCAGG + Intergenic
1190640812 X:52481757-52481779 CAGGGGCTGGGGCTCAGAGCCGG + Intergenic
1190646860 X:52531108-52531130 CAGGGGCTGGGGCTCAGAGCCGG - Intergenic
1199744334 X:150762333-150762355 CGGGGGCCGAGCCGCTGAGCCGG - Intronic
1200128875 X:153830547-153830569 CGGGGGATGGGCGGGCGCGCCGG + Intronic
1200252417 X:154560569-154560591 CGGGGGCGGGGCCGCACCGCAGG + Intronic
1200265350 X:154643847-154643869 CGGGGGCGGGGCCGCACCGCAGG - Intergenic