ID: 992045692

View in Genome Browser
Species Human (GRCh38)
Location 5:72886724-72886746
Sequence CAGCTGATTTTTAGGAGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1357
Summary {0: 1, 1: 7, 2: 133, 3: 399, 4: 817}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992045692_992045703 28 Left 992045692 5:72886724-72886746 CCGTCTCTCCTAAAAATCAGCTG 0: 1
1: 7
2: 133
3: 399
4: 817
Right 992045703 5:72886775-72886797 GCTACTCAGGGGGCTAAAGCGGG 0: 4
1: 226
2: 7751
3: 97021
4: 194538
992045692_992045699 18 Left 992045692 5:72886724-72886746 CCGTCTCTCCTAAAAATCAGCTG 0: 1
1: 7
2: 133
3: 399
4: 817
Right 992045699 5:72886765-72886787 TGTAATCCCAGCTACTCAGGGGG 0: 53856
1: 140530
2: 227977
3: 201243
4: 144859
992045692_992045698 17 Left 992045692 5:72886724-72886746 CCGTCTCTCCTAAAAATCAGCTG 0: 1
1: 7
2: 133
3: 399
4: 817
Right 992045698 5:72886764-72886786 CTGTAATCCCAGCTACTCAGGGG 0: 1253
1: 3569
2: 5710
3: 6951
4: 7179
992045692_992045702 27 Left 992045692 5:72886724-72886746 CCGTCTCTCCTAAAAATCAGCTG 0: 1
1: 7
2: 133
3: 399
4: 817
Right 992045702 5:72886774-72886796 AGCTACTCAGGGGGCTAAAGCGG 0: 3
1: 164
2: 2875
3: 18997
4: 33493
992045692_992045695 15 Left 992045692 5:72886724-72886746 CCGTCTCTCCTAAAAATCAGCTG 0: 1
1: 7
2: 133
3: 399
4: 817
Right 992045695 5:72886762-72886784 ACCTGTAATCCCAGCTACTCAGG 0: 29735
1: 147997
2: 251626
3: 208111
4: 212677
992045692_992045697 16 Left 992045692 5:72886724-72886746 CCGTCTCTCCTAAAAATCAGCTG 0: 1
1: 7
2: 133
3: 399
4: 817
Right 992045697 5:72886763-72886785 CCTGTAATCCCAGCTACTCAGGG 0: 1176
1: 3158
2: 5349
3: 6278
4: 6334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992045692 Original CRISPR CAGCTGATTTTTAGGAGAGA CGG (reversed) Intronic
900167987 1:1251853-1251875 CAGCTAATTTTAAGTAGAGACGG - Intergenic
900631376 1:3637669-3637691 CGGCTGATATTTTGTAGAGATGG - Intronic
900860035 1:5222463-5222485 CAGCTAATTTTTTGTAGAGATGG + Intergenic
901230021 1:7636544-7636566 CGGCTAATTTTTAGTAGAGATGG - Intronic
901297035 1:8168740-8168762 CAGCTAATTTTTAGTAGAGACGG - Intergenic
901495173 1:9616871-9616893 CATCTTATTTTTTAGAGAGAGGG - Intergenic
901561568 1:10075879-10075901 CCGCTAATTTTTTGTAGAGACGG - Intronic
902341648 1:15787238-15787260 CAGCTCATTTTTCATAGAGACGG - Intergenic
902446084 1:16465446-16465468 CAGCTAATTTTTAGAAGAGGCGG - Intergenic
902560207 1:17272666-17272688 CAGCTAATTTTTTGTAGAGATGG + Intronic
902586888 1:17445007-17445029 CGGCTAATTTTTAGTAGAGACGG - Intergenic
902831991 1:19021117-19021139 CAGGTAATTTTTTGTAGAGAAGG - Intergenic
902837682 1:19057719-19057741 CGGCTGAGTTTCAGGAGACAGGG - Intergenic
903456759 1:23492774-23492796 CAGCAAATTTTTTGTAGAGATGG - Intergenic
903611271 1:24615202-24615224 CGGCTAATTTTTAGTAGAGTTGG - Intergenic
903927481 1:26840970-26840992 CAGCTAATTTTTTGGGGGGAGGG + Intronic
904098471 1:28001574-28001596 CAGCTAATTTTTAGTAGAGATGG - Intronic
904156373 1:28486694-28486716 CAGCTAACTTTTAATAGAGATGG - Intronic
904159554 1:28512955-28512977 CTGCTAATTTTTTGTAGAGATGG + Intronic
904573395 1:31484831-31484853 CGGCTAATTTTTAGTAGAGACGG - Intergenic
904716191 1:32469405-32469427 TGGCTAATTTTTAGTAGAGATGG + Intronic
904729703 1:32580385-32580407 TGGCTAATTTTTAGTAGAGACGG - Intronic
904746613 1:32715439-32715461 CGGCTAATTTTTAGTAGAGACGG + Intergenic
905122848 1:35695166-35695188 CAGCTAATTTTTAGTAGAAATGG + Intergenic
905435599 1:37953193-37953215 CAGCTAATTTTTTGTAGAGAAGG - Intergenic
905486477 1:38300783-38300805 CAGCTAGTTTTTAGCAGAGCTGG - Intergenic
905688590 1:39926511-39926533 CTGCTGATGTGGAGGAGAGATGG - Intergenic
906339163 1:44963050-44963072 CATCTAATTTTTTGAAGAGATGG - Intronic
906423696 1:45691378-45691400 CAGCTAATTTTTTGTAGAGATGG - Intronic
906502838 1:46354267-46354289 CAAATGATTTTTTGTAGAGACGG + Intronic
906628332 1:47343903-47343925 CAGCTAATTTTTTGTAGAGATGG - Intronic
906658963 1:47569037-47569059 CAGCTTATTTTTAGAAAAGGGGG - Intergenic
906998984 1:50830278-50830300 CAACTAATTTTTGGTAGAGATGG + Intronic
907141486 1:52189541-52189563 TTGTTGATTTTTAGTAGAGATGG + Intronic
907227350 1:52960339-52960361 CAGCTAATTTTTTGCAGAGACGG + Intronic
907343300 1:53752815-53752837 CAGCTAATTTTTTGTAGAGATGG - Intergenic
907770353 1:57455784-57455806 CAGCTGAAGATTAGGAGAGAGGG - Intronic
907886432 1:58596441-58596463 CCGCTAATTTTTAGTAGAGACGG + Intergenic
908189654 1:61688872-61688894 CAGCTAATTTTTAGTAGAGATGG - Intronic
908275040 1:62461733-62461755 CAACTGATTTTTGGTAGAGCAGG + Intronic
908883177 1:68756809-68756831 CGGCTGATTTTTAGTAGAGATGG - Intergenic
909261729 1:73498689-73498711 CAGCTGATTTTAGGGAGGGGAGG - Intergenic
910798198 1:91119413-91119435 CAGCTTATTTTTATTAGAGTCGG - Intergenic
910860993 1:91742167-91742189 CAGCTCATTGTGAGGAGAGTAGG - Intronic
911080440 1:93923892-93923914 TATCTGATTTTTTTGAGAGATGG + Intergenic
911145723 1:94550631-94550653 CAGCTGCTTTTTAGCTGAGTGGG + Intergenic
911155765 1:94635225-94635247 GGGCTGATTTTTATGAGACAAGG - Intergenic
911158649 1:94660613-94660635 CAGATAATTTTGAGGAGAAAAGG + Intergenic
911207308 1:95104855-95104877 CAGCTAATTTTTTGTAGAGATGG - Intergenic
911637699 1:100253669-100253691 CAGCTAATTTTTTGTAGAGATGG - Intergenic
911940508 1:104041401-104041423 CAGCTTTTTTTTAGTAGAGACGG + Intergenic
911955249 1:104225398-104225420 CAGCTGAATCTTAGGAAAAACGG + Intergenic
912117556 1:106425627-106425649 TTCCTGATTTTTAGTAGAGATGG - Intergenic
912367216 1:109144220-109144242 CGGCTAATTTTTTGTAGAGACGG + Intronic
912398284 1:109366318-109366340 CAGATTATTTTTAGGTAAGAAGG - Intronic
912756253 1:112326855-112326877 CAGCTAATTTTTTGTAGAGATGG + Intergenic
912769784 1:112452950-112452972 CTGCTGATTTTTTGTAGAAATGG - Intronic
912902329 1:113665271-113665293 AAGTTGATATATAGGAGAGATGG - Intronic
913005809 1:114630140-114630162 CAGCTAATTTTTAGTAGAGATGG - Intronic
913012855 1:114701613-114701635 TAGCTGATTTTTTGTAGAGAAGG - Intergenic
913113371 1:115675627-115675649 TGGCTGATTTTTAGTGGAGATGG - Intronic
913407072 1:118506233-118506255 CAGCTGATGTTTGAGAGACATGG - Intergenic
914338361 1:146737595-146737617 CAGCTAATTTTTTGTAGAGACGG + Intergenic
914351956 1:146847699-146847721 CAGCTAATTTTTGGTAGAGATGG - Intergenic
914355404 1:146880364-146880386 TGGCTAATTTTTAGTAGAGACGG - Intergenic
914749554 1:150525122-150525144 TGGCTAATTTTTAGCAGAGATGG - Intergenic
915144681 1:153789482-153789504 CGGCTAATTTTTTGTAGAGATGG + Intergenic
915295699 1:154920019-154920041 TGGCTAATTTTTAGTAGAGATGG + Intergenic
915502757 1:156330749-156330771 TGGCTAATTTTTAGTAGAGATGG - Intronic
915888106 1:159744978-159745000 CAGCTAATTTTTAGTAGAGATGG - Intergenic
916413701 1:164573654-164573676 CTGCTAATTTTTAGTAGAGATGG + Intronic
916743708 1:167668119-167668141 TTGCTAATTTTTAGTAGAGACGG - Intronic
917347029 1:174038839-174038861 CGACTAATTTTTAGTAGAGATGG + Intergenic
917389751 1:174522404-174522426 CAGCTAAGTTTTTGTAGAGATGG - Intronic
917820082 1:178753992-178754014 CGGCTAATTTTTAATAGAGACGG + Intronic
917952673 1:180056630-180056652 CAGGTAATTTTTTGTAGAGATGG + Intronic
918079672 1:181196083-181196105 CAGCTAATTTTTGGTAAAGATGG - Intergenic
918084258 1:181231772-181231794 CAGCTAATTTTTAGTAGAGATGG - Intergenic
918149651 1:181787280-181787302 CAGCTAATTTTTAGTAGAGACGG + Intronic
918424976 1:184399523-184399545 CAGCTAATATTTTGTAGAGAGGG + Intronic
918482887 1:184998519-184998541 CAGCTAATTTTTTGTAGATATGG - Intergenic
919496072 1:198269849-198269871 CAGATGAGTTTTAGGATAAAAGG + Intronic
919680534 1:200430452-200430474 CACCTGATATTAATGAGAGATGG + Intergenic
919904166 1:202066467-202066489 CAGCTAATTTTTTGTAGAGATGG + Intergenic
919911828 1:202115957-202115979 CAGCTAAATTTTAGTGGAGACGG + Intergenic
920148365 1:203882742-203882764 CAGCTAATTTTTAGTAGAGACGG - Intergenic
920187296 1:204167962-204167984 CAGCTAATTTTTTTCAGAGATGG - Intergenic
920792801 1:209108629-209108651 CACCTTCTTTGTAGGAGAGAAGG - Intergenic
920843815 1:209576914-209576936 CAGCTCATTCTTGGGAGTGAGGG + Intergenic
921310122 1:213834193-213834215 CAGCTAATTTTTTGTAGAGATGG + Intergenic
921710448 1:218368305-218368327 TGGCTAATTTTTAGTAGAGACGG + Intronic
922018515 1:221677663-221677685 AAGGTTATTTTTAGGAGAAATGG - Intergenic
922336927 1:224625375-224625397 TATTTTATTTTTAGGAGAGATGG - Intronic
922353734 1:224756818-224756840 CTGCTAATTTTTAGTAGAGATGG + Intergenic
922738018 1:227999915-227999937 CAGCTAATTTTTTATAGAGACGG + Intergenic
922895330 1:229095743-229095765 AAGCTAATTTTTTGTAGAGATGG - Intergenic
922970860 1:229736716-229736738 CAGCTAATTTTTTGTAGAGATGG - Intergenic
923236853 1:232042469-232042491 CAGATGATTTTAAGTTGAGAAGG + Intergenic
923307188 1:232698982-232699004 TGGCTAATTTTTAGAAGAGATGG - Intergenic
923574538 1:235146122-235146144 CAGCTAATTTTTTGTAGAGATGG + Intronic
923677726 1:236094784-236094806 CAGCTAATTTTTGGCAGAGACGG + Intergenic
923724074 1:236491399-236491421 TGGCTAATTTTTAGTAGAGACGG + Intergenic
923740272 1:236648225-236648247 CAGCTAATTTTTTGCAGAAACGG - Intergenic
923842608 1:237690005-237690027 CGGCTAATTTTTAGTAGAAACGG + Intronic
923856851 1:237854456-237854478 CAGCTAATTTTTAGTAGAGACGG + Intergenic
923864949 1:237929798-237929820 CGGCTAATTTTTTGTAGAGATGG + Intergenic
924049750 1:240068950-240068972 CAGGGGATTTTTAGGAGAAGTGG - Intronic
924077560 1:240356633-240356655 AATCTGATCTTTAGAAGAGATGG - Intronic
924252064 1:242142886-242142908 TGGCTGATTTTTAGTAGAGATGG + Intronic
924758891 1:246966316-246966338 CAGCTAATATTTAGTAGAGATGG - Intronic
924854976 1:247866969-247866991 CAACTGTTTTTAAGGGGAGAGGG + Intronic
1062869743 10:889777-889799 TGGCTAATTTTTAGTAGAGATGG - Intronic
1062994317 10:1851608-1851630 CAGCTAATTTTTAGTAGAGACGG - Intergenic
1063369803 10:5513836-5513858 TGGCTTATTTTTAGTAGAGACGG + Intergenic
1063773770 10:9236320-9236342 CAGCTAATTTGTAGTAGAGCTGG - Intergenic
1063790714 10:9443050-9443072 CAGCTAATTTTTAGTAGAGATGG - Intergenic
1063903731 10:10762156-10762178 CATCAGAGATTTAGGAGAGAAGG + Intergenic
1063955687 10:11263597-11263619 AAGCTCATTTTTAGTAGAAAGGG + Intronic
1064095551 10:12421977-12421999 TGGCTAATTTTTAGTAGAGATGG + Intronic
1064453555 10:15465753-15465775 CAGCTAATTTTTTGTAGAGATGG - Intergenic
1064650488 10:17504369-17504391 CAGCTAATTTTTTGCAGAGATGG - Intergenic
1064759355 10:18602404-18602426 CGGCTAATTTTTTGTAGAGATGG + Intronic
1065158754 10:22897104-22897126 CAGCTCATTTTTCAGTGAGAGGG - Intergenic
1065356175 10:24844202-24844224 TGGCTAATTTTTAGTAGAGATGG + Intergenic
1065950228 10:30644778-30644800 CAGCAGAGTTTTAGGAGCCAGGG + Intergenic
1066592115 10:37006789-37006811 CAGCTAATTTTTAGTAGAGAAGG + Intergenic
1067072312 10:43142372-43142394 CGGCTAATTTTTAGTAGAGACGG + Intronic
1067074366 10:43165817-43165839 TGGCTAATTTTTAGTAGAGATGG - Intronic
1067105462 10:43363069-43363091 CGGCTAATTTTTAGTAGAGATGG - Intergenic
1067116511 10:43439235-43439257 CAGCTGATTTTTTTTTGAGACGG - Intronic
1067147905 10:43706728-43706750 CAGCAGTTTGTAAGGAGAGATGG + Intergenic
1067521274 10:47008471-47008493 CATCTGATTTGTAAGAGAGATGG - Intergenic
1068009863 10:51434692-51434714 CATCTGATTTTTAGGAATTATGG + Intronic
1069457681 10:68566000-68566022 AGGCTGTTTTTTAGGAGATAGGG + Intronic
1069485357 10:68819094-68819116 CAGCTAATTTTTTGTAGATATGG + Intergenic
1069523523 10:69146255-69146277 CAGCTAATTTTTAGTACAGACGG + Intronic
1069814897 10:71187458-71187480 CGGCTAATTTTTACTAGAGACGG - Intergenic
1070062594 10:72999032-72999054 CAGCTAGTTTTTTGTAGAGATGG + Intergenic
1070150022 10:73799758-73799780 CAGCTAATTTTTAGTAGAGACGG - Intronic
1070200079 10:74195972-74195994 CAGCCAATTTTTTGTAGAGATGG + Intronic
1070208385 10:74287817-74287839 CAGCTAATTTTTTGTAGAGATGG - Intronic
1070286893 10:75090125-75090147 CAGCTGACTTTTTGTAGAGACGG - Intergenic
1071049364 10:81427934-81427956 CAGCCAATCTTTAGTAGAGATGG - Intergenic
1071299805 10:84247917-84247939 CAGCTGATTTCTGGAAGACAGGG + Intronic
1071335831 10:84599820-84599842 GAGCTGATTTTTTGGAGATGAGG + Intergenic
1072070500 10:91910567-91910589 CAGCTAATTTTTAGTGGAGAAGG + Intergenic
1072160253 10:92759739-92759761 CAGCTAATTTTTCATAGAGAAGG + Intergenic
1072514649 10:96167288-96167310 CAATTTATTTTTAGTAGAGACGG - Intronic
1072582226 10:96749554-96749576 CTGCTAATTTTCAGTAGAGACGG - Intergenic
1072640636 10:97208585-97208607 TAGCTAATTTTTTGTAGAGATGG - Intronic
1072675799 10:97465170-97465192 CAGATAATTTTTAGTAGAGACGG + Intronic
1073114004 10:101080766-101080788 CAGCTAATTTTTTGTAGAGATGG + Intergenic
1073373316 10:103010398-103010420 CGGCTAATTTTTTGTAGAGATGG + Intronic
1073399314 10:103243870-103243892 CAGCTATTTTTCTGGAGAGATGG - Intergenic
1073496868 10:103899522-103899544 CAGCTAATTTTTTGTAGAGATGG - Intronic
1073595342 10:104794018-104794040 CAGCAGATTTTTAGGAGAATAGG + Intronic
1073727618 10:106252648-106252670 CAGCTGATTTCAAGTACAGATGG + Intergenic
1074138587 10:110650350-110650372 CAGCAGATCTGTAGGGGAGATGG + Intronic
1074173613 10:110972672-110972694 CAGCTAATTTTTTGTAGAGACGG - Intronic
1074921751 10:118021415-118021437 CAGCAGGTCTCTAGGAGAGAGGG - Intronic
1074935023 10:118169697-118169719 CAGCCAGTTTTTAGTAGAGATGG - Intergenic
1075368660 10:121916062-121916084 CGGCTAATTTTTTGTAGAGACGG - Intronic
1075516869 10:123116462-123116484 CAGCAGATATTTAACAGAGAGGG - Intergenic
1076126690 10:127979672-127979694 CAGCTGATTTTTAAAAAATAAGG - Intronic
1077617499 11:3688241-3688263 CGGCTAATTTTTAGTAGAGACGG - Intronic
1078129712 11:8603132-8603154 CAGCTAATTTTTAGCAAAGACGG - Intergenic
1078372158 11:10757418-10757440 CGGCTGATTTTCTGTAGAGATGG - Intronic
1078655531 11:13235306-13235328 CAGTTAATTTTTTGTAGAGATGG - Intergenic
1079293533 11:19210655-19210677 CGGCTAATTTTTAGTAGAGACGG + Intergenic
1079956704 11:26875343-26875365 CAGGTAATTTTTTGTAGAGATGG - Intergenic
1080476882 11:32603902-32603924 CAGCTAATTTTTGGTAGAGATGG - Exonic
1080524819 11:33104599-33104621 AAGCTAATTTTTTGTAGAGATGG - Intronic
1080554235 11:33401722-33401744 CAGCTAATTTTTTGTAGAGATGG + Intergenic
1080859450 11:36140589-36140611 CAGCTAATTTTTTGTAGAGATGG + Intronic
1081795600 11:45817176-45817198 CAGCTAATTTTTTGTAGCGATGG - Intergenic
1082038343 11:47664206-47664228 TAGCTGATTCTTAGGGGATAGGG - Intronic
1082040590 11:47681628-47681650 CAGCTAATTTTTAGTAGAGATGG + Intronic
1082799600 11:57404903-57404925 CGGCTAATTTTTAGTAGAGACGG + Intronic
1083294760 11:61709404-61709426 CCGCTAATTTTTTGTAGAGACGG + Intronic
1083411176 11:62493502-62493524 AAGCTTATTTTTAGTAGAGACGG + Intronic
1083573926 11:63775712-63775734 CAGCTAATTTTTAGTAGAGACGG - Intergenic
1083728075 11:64638554-64638576 CAGCTGTCTTCTAGGAGACACGG + Intronic
1083834938 11:65260494-65260516 CCGCTAATTTTTTGTAGAGAAGG + Intergenic
1083848034 11:65347816-65347838 TGGCTAATTTTTAGTAGAGACGG + Intronic
1084230607 11:67750037-67750059 CAGATGCCTTTGAGGAGAGATGG + Intergenic
1084558661 11:69890435-69890457 CAGCTGGTTTTTGGCAGTGATGG - Intergenic
1084565501 11:69926250-69926272 AAGCTGGTTTCTAGGAGGGAAGG + Intergenic
1084622830 11:70285167-70285189 CGGCTAATCTTTAGTAGAGACGG + Intronic
1084626794 11:70313853-70313875 CAGCTAATTTTCTGGAGAGATGG - Intronic
1084897643 11:72286092-72286114 CAGCTAATTTTTTGCAGAGATGG + Intergenic
1085073500 11:73570569-73570591 CAGCTAATTTTTTGTAGAGGTGG - Intronic
1085151364 11:74254911-74254933 CAGCCGATAATTAGGAGAGATGG - Intronic
1085327439 11:75617857-75617879 CAGTTGAGATTGAGGAGAGAAGG + Intronic
1085691099 11:78664394-78664416 TAGCTAATTTTTTGTAGAGATGG + Intronic
1086428001 11:86705870-86705892 CAATTGATTGTTAAGAGAGAGGG - Intergenic
1086614332 11:88797310-88797332 CCGCTAATTTTTAGTAGAGACGG + Intronic
1087178128 11:95114277-95114299 TAGCTAATTTTTTGTAGAGACGG + Intronic
1087191738 11:95261660-95261682 CAGCTAATTTTTTGTAGAGACGG + Intergenic
1087261652 11:96018757-96018779 TGGCTAATTTTTAGTAGAGATGG + Intronic
1087430687 11:98050153-98050175 AAGCTAACTTTTAGGAAAGATGG - Intergenic
1087805213 11:102548012-102548034 CAGCTAATTTTTAGTAGAGAAGG + Intergenic
1088274269 11:108068086-108068108 CGGCTAATTTTTAGTAGAGATGG + Intronic
1088281545 11:108139821-108139843 CGGCTAATTTTTAGTAGAGACGG + Intronic
1088314137 11:108490047-108490069 CAGCTAATTTTTTGTAGAGATGG + Intronic
1088638529 11:111848425-111848447 CAGCTAATTTTTAGTAGAGATGG - Intronic
1088794056 11:113252241-113252263 CGGCTAATTTTTTGTAGAGATGG - Intronic
1089195235 11:116690464-116690486 CGCCTAATTTTTAGTAGAGATGG - Intergenic
1089250090 11:117152897-117152919 TAACTTATTTTTAGTAGAGACGG - Intronic
1089480123 11:118797759-118797781 CAGCTTATTTTTTGTAGAGGCGG - Intergenic
1089991101 11:122860865-122860887 CAGCTATTTTTTTGTAGAGATGG + Intronic
1090821200 11:130343301-130343323 CAGCTAATTTTTAGTAGAGATGG - Intergenic
1090956883 11:131521150-131521172 CGGCTTATTTTTAGTAAAGATGG - Intronic
1091141089 11:133235344-133235366 CAACTGCCTCTTAGGAGAGAGGG - Intronic
1091499820 12:1005311-1005333 CAGCTAATTTTTTGTAGAGATGG + Intronic
1091609913 12:1997355-1997377 CAGCTAATTTTTAGTAGCAACGG - Intronic
1091647567 12:2285353-2285375 CAACTGGCTTTTAGGAGAGGGGG - Intronic
1091961549 12:4699338-4699360 CACGTAATTTTTAGTAGAGACGG - Intronic
1092145024 12:6208732-6208754 CGGCTAATTTTTAGTAGAGACGG + Intronic
1092149466 12:6237143-6237165 CTGATTATTTTTAGTAGAGATGG + Intronic
1092187470 12:6491469-6491491 CACTTTATTTTTAGTAGAGACGG + Intergenic
1092888593 12:12947725-12947747 CAGCTAATTTTTTGTAGAGACGG + Intronic
1093016448 12:14159856-14159878 CAGCTAATTTTTTGTAGAGGTGG - Intergenic
1093030809 12:14286856-14286878 AAACTGACTTTTGGGAGAGAAGG - Intergenic
1093449994 12:19303976-19303998 CAGCTAATTTTTTGTAGAGGGGG + Intronic
1093710081 12:22320398-22320420 CAGCTGATTTATACTAGGGAAGG + Intronic
1093930553 12:24951423-24951445 CGGCTAATTTTTAGTAGAGACGG - Intergenic
1093949408 12:25147483-25147505 CAGCTAATTTTTTGTAGAGATGG - Intronic
1093959003 12:25251777-25251799 CAACTGTTTTTAAGTAGAGATGG + Intergenic
1093969184 12:25359205-25359227 CAACTAATTTTTTGTAGAGACGG + Intergenic
1094419320 12:30254278-30254300 TAGCTGGTTTTTAGGAAAAAAGG - Intergenic
1095092889 12:38123468-38123490 CATTTGATTATTAGGTGAGATGG - Intergenic
1095166698 12:38981668-38981690 TGGCTAATTTTTAGTAGAGACGG - Intergenic
1095304795 12:40626515-40626537 CAGCAAATTTTTTGTAGAGACGG - Intergenic
1095417732 12:41994732-41994754 CGGCTAATTTTTTGTAGAGATGG - Intergenic
1095578669 12:43769487-43769509 CAGCTAATTTTTTGTAGTGATGG - Intronic
1095662378 12:44752718-44752740 AAGATGATTTTCAGGAGACAAGG - Intronic
1096055391 12:48646456-48646478 TGGCTAATTTTTAGTAGAGAGGG - Intergenic
1096074041 12:48790807-48790829 CAGCTAATTTTTAATAGAGACGG - Intergenic
1096093658 12:48919948-48919970 CAGCTTTTTTTTGGTAGAGATGG - Intronic
1096320920 12:50612098-50612120 CTGCTAATTTTTTGTAGAGATGG - Intronic
1096384339 12:51184914-51184936 CAGCTGAGTGTCAGGGGAGAGGG + Intergenic
1096580600 12:52582353-52582375 CAGCTGGTTTGCAGGAGAGGAGG + Intergenic
1096641220 12:52995849-52995871 CAGATTATTTTTAGTAGAGATGG - Intergenic
1096647385 12:53046319-53046341 CAGCTAATTTTTTGTAGAGATGG - Intergenic
1096762938 12:53858496-53858518 CAGCTAATTTTTAGTAGAGACGG - Intergenic
1096825717 12:54275833-54275855 CGGCTAATTTTTAGTAGAGACGG - Intronic
1096957264 12:55539416-55539438 CAGCTAATTTTTTGTAGACATGG + Intergenic
1097071442 12:56357870-56357892 CAGCTAATTTTTTGTAGAGATGG + Intronic
1097113594 12:56680940-56680962 CAGGTTATTTTTTGTAGAGATGG + Intronic
1097211352 12:57373037-57373059 CAGCTAATTTTTTGTAGAGATGG - Intronic
1097671934 12:62550357-62550379 CAGCTAATTTTTAGTAGAGATGG - Intronic
1097686817 12:62698941-62698963 CAGCTGATATTTTGGATGGAAGG - Intronic
1097819947 12:64118430-64118452 CAGCTAATTTTTTGTAGAGATGG + Intronic
1097870912 12:64601649-64601671 CAGCTAATTTTTTGTAGAGACGG - Intergenic
1097892055 12:64786778-64786800 CAGCTAATTTTTAGTAGAGATGG - Intronic
1097978960 12:65717577-65717599 CAGCTAATTTTTTGTAGAGACGG + Intergenic
1098029912 12:66242901-66242923 CGGCTAATTTTTAGTAGAGATGG - Intronic
1098089741 12:66888531-66888553 CACATTATTTTTAGTAGAGACGG + Intergenic
1098219930 12:68258457-68258479 TGGCTAATTTTTAGTAGAGATGG + Intergenic
1098255184 12:68609408-68609430 CAGCTAATTTTTAGTAGAAAGGG - Intergenic
1098428881 12:70397185-70397207 CAGCTAATTTTTTGTAGAGAAGG - Intronic
1098730710 12:74034550-74034572 CAGACAATTTTTAGTAGAGATGG + Intergenic
1099671117 12:85693952-85693974 CAGCTAATTTTTTGTAGAGATGG - Intergenic
1099875407 12:88399008-88399030 TAGATAATTTTTAGTAGAGATGG + Intergenic
1099945783 12:89242628-89242650 CAGCTAATTTTTTGTAGAGATGG + Intergenic
1100105684 12:91169224-91169246 CAGCTAATTTTTTGTAAAGATGG - Intronic
1100315062 12:93437624-93437646 TGGCTAATTTTTAGTAGAGATGG - Intronic
1100357104 12:93841779-93841801 CAGCCGCTTTTTAGAAGACAGGG - Intronic
1100612284 12:96201448-96201470 TAGCTAATTTTTGGCAGAGATGG - Intronic
1100621838 12:96284296-96284318 TGGCTAATTTTTAGTAGAGACGG - Intronic
1100828863 12:98499771-98499793 CGGCTAATTTTTGGTAGAGATGG - Intronic
1100987785 12:100220822-100220844 CGGCTAATTTTTTGTAGAGACGG - Intronic
1101065459 12:101016047-101016069 CAGCTGATAGCTAGAAGAGATGG + Intronic
1101173299 12:102121714-102121736 CAGCTAATTTTTAGTAGACAGGG + Intronic
1101359626 12:104014190-104014212 CAGCTAATTTTTTGTAGAAATGG - Intronic
1101931208 12:109015633-109015655 CAGCTAATTTTTTATAGAGATGG - Intronic
1101955439 12:109208376-109208398 CAGCTAATTTTTTGTAGAGACGG + Intronic
1102019502 12:109672023-109672045 CAATTTATTTTTAGTAGAGATGG - Intergenic
1102247502 12:111364599-111364621 TGGCTGTTTTTTAGTAGAGATGG - Intronic
1102328797 12:112012447-112012469 CGCCTGATTTTTAGTAGAAACGG + Intronic
1102342637 12:112135594-112135616 CAGCTAATTATTAGTAGAGACGG + Intronic
1102642665 12:114380665-114380687 CAGCTAATTTTTTGTAGCGACGG - Intronic
1102663414 12:114549188-114549210 AAAATGATTTTTAGCAGAGAGGG + Intergenic
1102689590 12:114750033-114750055 CAGCTAAGTTTTTGTAGAGATGG - Intergenic
1102834480 12:116041670-116041692 CAGCTAATTTTTGGTAGAGACGG - Intronic
1102835825 12:116059228-116059250 CAGCTAATTGTTTGTAGAGATGG + Intronic
1103022589 12:117547921-117547943 CAGAATATTTTTAGTAGAGATGG - Intronic
1103341453 12:120223269-120223291 TGGCTAATTTTTAGTAGAGACGG - Intronic
1103355702 12:120318289-120318311 TTGCTGATTTTTTGTAGAGACGG + Intergenic
1103529568 12:121591459-121591481 CTGCTAATTTTTTGTAGAGATGG - Intergenic
1103622327 12:122195409-122195431 CAGCTGATTTTTAGTTGAGGCGG + Intronic
1103719992 12:122968440-122968462 AGGATTATTTTTAGGAGAGATGG + Intronic
1103807664 12:123585773-123585795 CAGCTGATTTGTAGCAGACTGGG + Intronic
1104781592 12:131424063-131424085 CATCTGTTTTCTAAGAGAGAAGG - Intergenic
1104888073 12:132123716-132123738 AAGTTTATTTTTAGTAGAGATGG - Intronic
1105018322 12:132799634-132799656 CTGCTGTTTTTTCGGAGACAGGG - Intronic
1105276849 13:18937803-18937825 CAGGTGATTTTGATGAGAGCAGG - Intergenic
1105454515 13:20527699-20527721 TGGCTAATTTTTAGTAGAGACGG - Intergenic
1106186480 13:27414379-27414401 TTTCTTATTTTTAGGAGAGACGG + Intergenic
1106807509 13:33325820-33325842 CGGCTAATTTTTTGTAGAGACGG - Intronic
1107040162 13:35939565-35939587 CAGTTAATTTTTTGTAGAGATGG + Intronic
1107139338 13:36980395-36980417 TGGCTAATTTTTAGTAGAGACGG + Intronic
1107483338 13:40803375-40803397 TGGCTAATTTTTAGTAGAGACGG + Intronic
1107569580 13:41642756-41642778 CTTCTTATTTTTAGTAGAGATGG - Intronic
1107585784 13:41846864-41846886 TGGCTAATTTTTAGTAGAGATGG - Intronic
1108213712 13:48162966-48162988 CAGCTGTATTTTAGTAGAGACGG - Intergenic
1108218936 13:48213615-48213637 CAGCTAATTTTTTGTAGAGATGG + Intergenic
1108335832 13:49441402-49441424 TGGCTAATTTTTTGGAGAGATGG - Intronic
1108339465 13:49483788-49483810 CAGCTCTTATTTAGTAGAGATGG + Intronic
1109223451 13:59664283-59664305 TGGCTAATTTTTAGTAGAGACGG - Intergenic
1109428072 13:62193992-62194014 TAGCTAATTTTTTGAAGAGATGG - Intergenic
1109518437 13:63475966-63475988 CAGCTAATTTTTAATAGAGACGG + Intergenic
1109625261 13:64965637-64965659 CATCTAATTTTTAGTAGAGATGG - Intergenic
1110281467 13:73698805-73698827 CCCCTGATTTTTATAAGAGATGG + Intronic
1110928672 13:81187637-81187659 CTGCTAATTTTTGGTAGAGATGG - Intergenic
1111053816 13:82921666-82921688 TGGCTAATTTTTAGTAGAGACGG - Intergenic
1111163920 13:84432612-84432634 CATCTGCTTTTTAGGAGACCTGG - Intergenic
1111293406 13:86197750-86197772 CAGCTGAATTTTAAGAGGAATGG - Intergenic
1111436099 13:88210239-88210261 CATCTGTTATTGAGGAGAGAAGG + Intergenic
1111994404 13:95150134-95150156 CAGCTAATTTTTTTTAGAGATGG + Intronic
1112021352 13:95373855-95373877 CAGGGTATTTTTAGTAGAGACGG + Intergenic
1112319155 13:98391439-98391461 CAGCTAAATTTTTGTAGAGATGG + Intronic
1112360227 13:98710643-98710665 TGGCTAATTTTTAGTAGAGACGG - Intronic
1113088241 13:106590698-106590720 CAGCTAATTTTTAGTAGAGATGG + Intergenic
1113846024 13:113392208-113392230 CAGCTAACTTTTTGTAGAGATGG + Intergenic
1113959494 13:114118778-114118800 CTGCTGACTTTCAGCAGAGAAGG - Intronic
1114291931 14:21295644-21295666 CAGCTAATTTTTAGTATAGACGG + Intronic
1114819591 14:26002212-26002234 CAGCAAACTTTTAGGACAGAAGG + Intergenic
1115244731 14:31283250-31283272 TAGCTAATTTTTTGTAGAGATGG - Intergenic
1115622014 14:35150014-35150036 CGGCTAATTTTTAGTAGAGATGG + Intronic
1115686663 14:35803792-35803814 CTGGTTATTTTTAGTAGAGATGG + Intronic
1115938476 14:38582450-38582472 CAACTGATTAATAGGAGAAAAGG + Intergenic
1117077019 14:52115157-52115179 CAGCTAATTTTTTGTAGCGATGG + Intergenic
1117113902 14:52489997-52490019 CAGCCAATTTTTTGTAGAGATGG + Intronic
1117154122 14:52920780-52920802 CAGCTAATTTTTTGTAGAGATGG - Intronic
1117265310 14:54080272-54080294 CAGCTAATTTTTAGTAGAGATGG + Intergenic
1117375339 14:55113828-55113850 CGGCTAATTTTTTGTAGAGACGG + Intergenic
1117388273 14:55238390-55238412 CAACTAATTTTTTGTAGAGACGG + Intergenic
1117506311 14:56406558-56406580 CAGCTAATATTTTGTAGAGATGG - Intergenic
1117671445 14:58110922-58110944 CAGCTAATTTTTAGGAGAGACGG + Intronic
1117834044 14:59783421-59783443 CAGCTGAATTTTGGAAGGGATGG + Intronic
1117926465 14:60784633-60784655 TGGCTAATTTTTAGTAGAGATGG + Intronic
1118264669 14:64283586-64283608 TGGCTAATTTTTAGTAGAGACGG - Intronic
1118578343 14:67267419-67267441 TGGCTAATTTTTAGTAGAGATGG + Intronic
1119133809 14:72198188-72198210 CAGCTTATTTTTTGTAGAGATGG - Intronic
1119213895 14:72853635-72853657 TGGCTAATTTTTAGTAGAGACGG + Intronic
1119249285 14:73137903-73137925 CAGCTAATTTTTTGTAGAGCCGG - Intronic
1119281696 14:73414554-73414576 CAGCTAATTTTTCATAGAGATGG + Intronic
1119437462 14:74606674-74606696 CAGCTAATTTTTAGTAGAGACGG - Intronic
1119832886 14:77719074-77719096 CAGCTAATTTTTTGTAGACAGGG + Intronic
1119949250 14:78727570-78727592 TGGCTAATTTTCAGGAGAGATGG - Intronic
1120034954 14:79686119-79686141 CAGCTAATTTTTAGGAGAGATGG - Intronic
1120756116 14:88246080-88246102 GAGCCTATTTTTAGTAGAGACGG + Intronic
1120925740 14:89795502-89795524 CGGCTAATTTTTAGTAGAGAAGG - Exonic
1121160497 14:91734890-91734912 CAGCTAATTTTTAGTAAAGATGG + Intronic
1121344499 14:93125354-93125376 TGGCTAATTTTTAGTAGAGATGG - Intergenic
1122319269 14:100844000-100844022 GAGCTAGTTTTTAGTAGAGACGG + Intergenic
1122469533 14:101956734-101956756 CAGCTTATTTTTCGTAGAGATGG + Intergenic
1122505647 14:102230201-102230223 CAGCTAATTTTTAAAACAGATGG + Intronic
1122729253 14:103783420-103783442 GGGCTAATTTTTAGCAGAGATGG + Intronic
1123969229 15:25489749-25489771 CAGCTAATTTTTAGTAGAGATGG - Intergenic
1124568587 15:30838705-30838727 TGGCTTATTTTTAGTAGAGACGG - Intergenic
1124621105 15:31274534-31274556 CAGCTGATGTTGAGGAAACATGG + Intergenic
1125201822 15:37107010-37107032 CAGCTCAGTTTTAGGTCAGAAGG + Intergenic
1125342131 15:38685629-38685651 AAGCTGATTAATAGGAGACAAGG - Intergenic
1125626136 15:41110599-41110621 CGGCTAATTTTTTGTAGAGATGG + Intronic
1125774412 15:42198511-42198533 CAGCTAATTTTTTGTAGACAGGG + Intronic
1126156023 15:45566344-45566366 CGGCTTATTTTTTGTAGAGATGG - Intergenic
1126259436 15:46670983-46671005 CGGCTAATTTTTTGTAGAGATGG + Intergenic
1126346834 15:47704546-47704568 CAGCTAATTTTTTGTAGAGATGG - Intronic
1126409677 15:48360119-48360141 CAGCTAATTTTTGGTAGAGATGG - Intergenic
1126625659 15:50684020-50684042 CTGCTAATTTTTAGTAGAGACGG + Intronic
1126759228 15:51954093-51954115 CAGCTAATTTTTAGTAAAGATGG + Intronic
1126771583 15:52062198-52062220 CAGCTAATTTTTAGTAGAGGTGG + Intronic
1126796727 15:52265699-52265721 CAGCTAATTTTTTGTAGAGATGG + Intronic
1126813243 15:52429772-52429794 CAGTTAATTTTTAATAGAGATGG + Intronic
1127098040 15:55533495-55533517 CTTTTGATTTGTAGGAGAGAAGG + Intergenic
1127150902 15:56074300-56074322 CAGCTAATTTTCTGTAGAGACGG - Intergenic
1127234778 15:57037276-57037298 CAGCTAATTTTTAGTAAAGATGG - Intronic
1127809670 15:62553320-62553342 TAGCTAATTTTTAGTAGAGATGG - Intronic
1128097425 15:64968175-64968197 CGGCTAATTTTTTGTAGAGATGG - Intronic
1128334850 15:66779293-66779315 CAGCTGATGGTCAGGAGAGGAGG - Intronic
1128377387 15:67087056-67087078 TGGCTAATTTTTAGTAGAGATGG + Intronic
1128625218 15:69194503-69194525 GAGCTAAATCTTAGGAGAGAAGG + Intronic
1128779528 15:70349848-70349870 TGGCTAATTTTTAGTAGAGACGG - Intergenic
1128922693 15:71626679-71626701 CAGATGATTTTTATCACAGAAGG - Intronic
1129653506 15:77507797-77507819 CAGCTGACTGTTGGGAGTGAAGG + Intergenic
1129753781 15:78083706-78083728 CAGCTAATTTTTTGTAGAGATGG - Intronic
1129810275 15:78504844-78504866 CGGCTAATTTTTTGTAGAGACGG - Intergenic
1129864948 15:78899614-78899636 CAACTTTTTTTTAGGAGACAGGG - Intergenic
1130021869 15:80238645-80238667 CAGCTAATTTTTAGTAGAAATGG + Intergenic
1130241413 15:82196345-82196367 CAGATTATTTATAGGAGAAAGGG + Intronic
1131196318 15:90358056-90358078 CGGCTAATTTTTAGTAGAGACGG + Intronic
1131482394 15:92793235-92793257 CGGCTAATTTTTTGTAGAGAAGG - Intronic
1131492986 15:92879155-92879177 GTGCTGATCTTTAGGAGGGAAGG - Intergenic
1132039517 15:98513208-98513230 CAGCTAATTTTTAGTAGAGATGG - Intronic
1132091247 15:98949539-98949561 CAGCTAATTTTTAGTAGAGATGG + Intronic
1132409783 15:101568072-101568094 CAGCTGTTTTTTTGTAGAGACGG + Intergenic
1132476162 16:139031-139053 CTTCTAATTTTTAGTAGAGATGG - Intergenic
1132752123 16:1462988-1463010 CAGCTAATATTTTGTAGAGATGG - Intronic
1132820063 16:1861703-1861725 CAGCTAATTTTTTGTAGAAATGG + Intronic
1133183017 16:4073255-4073277 CAGCTAATTTTTGGTAGAGACGG + Intronic
1133310681 16:4844596-4844618 CAGCTAATTTTTTGTAGAGGGGG - Intronic
1133656247 16:7867441-7867463 TAGCTGATGTTCAGGAGGGAGGG - Intergenic
1133733703 16:8597536-8597558 CAGCTAATTTTTTGTAGAGATGG - Intergenic
1133757012 16:8769394-8769416 CAGCTAATTTTTAGTAGAGATGG - Intronic
1133792943 16:9023273-9023295 CGGCTAATTTTTAGTAGAGATGG + Intergenic
1133800375 16:9080526-9080548 CGGGAGATTTTTAGTAGAGACGG - Intergenic
1133868098 16:9662610-9662632 CAGCTAATTTTTTATAGAGATGG + Intergenic
1133976922 16:10605847-10605869 TAGCTAATTTTTTGTAGAGATGG + Intergenic
1134021757 16:10925906-10925928 GAGCTGGTTTTTAGCGGAGACGG + Exonic
1134042117 16:11076729-11076751 GAGGTGATGTATAGGAGAGATGG - Intronic
1134116571 16:11553246-11553268 CAGCTTATTTTTAGTAGAGCTGG - Intronic
1134139695 16:11707254-11707276 TGGCTAATTTTTAGTAGAGATGG - Intronic
1134146094 16:11763964-11763986 CAGCTAATTTTTAATAGAGACGG + Intronic
1134154978 16:11835654-11835676 CAGCTTATTTTTGGTAAAGATGG + Exonic
1134446760 16:14336942-14336964 CAGCTAATTTTTGGTAGAGACGG + Intergenic
1134450449 16:14360091-14360113 CAGCTGATTTTTAATAGAGACGG - Intergenic
1134527605 16:14956444-14956466 CAGCTAATTTTTAGTAGAGATGG - Intergenic
1134590760 16:15451351-15451373 CAGCTAATTTTTAGTAGAGATGG + Intronic
1134616111 16:15652068-15652090 CGGCTAATTCTTAGTAGAGATGG + Intronic
1134643636 16:15849199-15849221 CGGCTTATTTTTTGTAGAGATGG + Intronic
1135344990 16:21681418-21681440 CAGCTAATTTTTTGTAGAGATGG - Intronic
1135426412 16:22340565-22340587 CGGTTAATTTTTAGTAGAGACGG - Intergenic
1135580782 16:23624679-23624701 AATTTTATTTTTAGGAGAGACGG + Intronic
1135645693 16:24159821-24159843 TAGCTAATTTTTTGTAGAGATGG - Intronic
1135982691 16:27160653-27160675 CAGCTAATTTTTTATAGAGACGG + Intergenic
1136051816 16:27656253-27656275 CAACTAATTTTTTGTAGAGATGG - Intronic
1136185018 16:28582770-28582792 CGGCTAATTTTTAGTAGAGATGG - Intronic
1136851549 16:33616370-33616392 CAGCTAATTTTTAGTAGAGATGG - Intergenic
1137294215 16:47074731-47074753 CGGCTCATTTTTATTAGAGACGG - Intergenic
1137398130 16:48131502-48131524 GAGGTGATTTTTTGGAGGGAAGG - Intronic
1137449954 16:48563190-48563212 CAGCTTATTTTTTGTAGAAATGG - Intronic
1137457509 16:48629408-48629430 CAGCTAATTATTAGCAGAGCCGG - Intergenic
1138185497 16:54973809-54973831 CACCTGATGTTGAAGAGAGAAGG - Intergenic
1138378139 16:56581112-56581134 CAGCTAATTTTTTGTAGAGACGG + Intergenic
1138407141 16:56805218-56805240 CAGCTAACTTTTTGTAGAGAGGG + Intronic
1138432749 16:56979675-56979697 CAGCTAATTTTTAGTAGAGGCGG + Intronic
1138468333 16:57210549-57210571 CGGCTGATTTTTAGTAGAGACGG - Intronic
1138517803 16:57546879-57546901 CAGCTAATATTTTGTAGAGATGG + Intronic
1138803306 16:60061744-60061766 CAGCTGATTCTTTTGAAAGATGG - Intergenic
1138872362 16:60906698-60906720 CAGCTTATTTTTAGTAGAGATGG + Intergenic
1139132752 16:64165769-64165791 CGGCTAATTTTTAGTAGAGATGG - Intergenic
1139166578 16:64573092-64573114 CCTCTGGTTTTGAGGAGAGAAGG - Intergenic
1139427595 16:66892669-66892691 TGGCTAATTTTTAGTAGAGATGG + Intronic
1139519976 16:67476057-67476079 TGGCTAATTTTTAGTAGAGATGG - Intronic
1139533813 16:67559231-67559253 CAGCTAATTTTTTGTAGAGATGG + Intergenic
1139542360 16:67627774-67627796 CAGCTGATTTTTTGTACAGACGG - Intronic
1139595057 16:67952626-67952648 CGGCTAATTTTTAGTAGAGATGG - Intronic
1139687923 16:68618665-68618687 AGGCTAATTTTTAGTAGAGACGG - Intergenic
1139982077 16:70867837-70867859 CAGCTAATTTTTGGTAGAGATGG + Intronic
1139995917 16:70979759-70979781 CAGCTAATTTTTTGTAGAGACGG - Intronic
1140341958 16:74173234-74173256 CAGCTAATTTTTAGTAGAGAGGG - Intergenic
1140415379 16:74770539-74770561 CAGCTAATTTTTTGTAGAGACGG + Intronic
1140471830 16:75219552-75219574 TGGCTAATTTTTAGTAGAGACGG + Intronic
1140477477 16:75246139-75246161 CAGCTAATTTTGTGTAGAGATGG + Intronic
1140713044 16:77695738-77695760 CAACTAATTTTTAGTAGAGACGG + Intergenic
1140739176 16:77926088-77926110 TGGCTAATTTTTAGTAGAGACGG - Intronic
1140766208 16:78160293-78160315 CAACTAATTTTTTGTAGAGATGG + Intronic
1140772388 16:78216891-78216913 CAGCTAATTTTTAGTAGAGATGG + Intronic
1140936793 16:79678740-79678762 TTTCTTATTTTTAGGAGAGATGG + Intergenic
1141056940 16:80826273-80826295 CAGCTAATTTTTAGTAGAGACGG + Intergenic
1141142612 16:81506740-81506762 CAGCTAATTTTTAGTAGAGACGG - Intronic
1141334820 16:83144852-83144874 CTGCTGTCTGTTAGGAGAGAAGG - Intronic
1141338682 16:83181949-83181971 CAGCTAATTAATAGAAGAGATGG - Intronic
1141738617 16:85873598-85873620 CAGATAATTTTTTGTAGAGACGG + Intergenic
1142384063 16:89751327-89751349 CAGCTGATTTTTTGTAGAGACGG - Intronic
1142404711 16:89881613-89881635 CTGCTAATTTTTTGTAGAGATGG + Intronic
1142441728 16:90102799-90102821 CATCTGGGTTTTTGGAGAGAAGG - Intergenic
1142560945 17:808463-808485 CAGATAATTTTTAGTAGAAACGG + Intronic
1142580478 17:938887-938909 CAGCTAATTTTTAGTAGAGACGG - Intronic
1142661767 17:1435220-1435242 CAGCTAATTTTTTGTAGAGATGG + Intronic
1142724553 17:1802979-1803001 CGGCTAATTTTAAGTAGAGATGG - Intronic
1142746840 17:1963603-1963625 GAGCGGATTTTGAGGTGAGAAGG + Intronic
1142792743 17:2280907-2280929 CAGCTAATTTTTTGTAGCGATGG - Intronic
1142969157 17:3599789-3599811 CAACTAATTTTTAGTAGAAATGG + Intergenic
1142980876 17:3670694-3670716 CATCTTATTTTTAGTAGAGATGG - Exonic
1143231169 17:5356811-5356833 CAGCTAATTTTTTGTAGAGACGG + Intronic
1143527605 17:7481581-7481603 CAGCTAAGTTTTAGGAAAGGAGG - Intronic
1143550201 17:7626029-7626051 CGGCTAATTTTTAGTAGAGACGG - Intronic
1143606268 17:7988160-7988182 TGGCTAATTTTTAGTAGAGATGG + Intergenic
1143763784 17:9124153-9124175 CTGCTGATTTTTAAGAAAAATGG - Intronic
1143819902 17:9552177-9552199 CAGCTAATTTTTTGTAGAGATGG - Intronic
1144014099 17:11177370-11177392 CAACTGAATTTTACTAGAGAGGG - Intergenic
1144035967 17:11366308-11366330 CAGCTAATTTTTTGTAGAGGTGG + Intronic
1144084031 17:11792109-11792131 TGGCTAATTTTTAGTAGAGATGG - Intronic
1144240073 17:13301898-13301920 TGGCTAATTTTTAGTAGAGACGG - Intergenic
1144240957 17:13311036-13311058 CAGCTGTTGTTTATGTGAGAGGG + Intergenic
1144399134 17:14877588-14877610 CAGCAGTTTTTTTGCAGAGATGG + Intergenic
1144701489 17:17343754-17343776 CAGCAGATTTTAAGCAGAGGAGG - Intronic
1144837556 17:18164667-18164689 TGGCTAATTTTTAGTAGAGATGG - Intronic
1144863705 17:18321667-18321689 CAGATAATTTTTTGTAGAGATGG - Intronic
1145035053 17:19534805-19534827 CACATTATTTTTAGGAGACAAGG - Intronic
1145748482 17:27338195-27338217 CAGCCAATTTTTAGTAGAGACGG - Intergenic
1145876673 17:28323833-28323855 CAGCTAATTTTCTGTAGAGACGG - Intronic
1145953050 17:28835205-28835227 TGGCTAATTTTTAGTAGAGACGG + Intronic
1146204269 17:30888379-30888401 CAGCCAATTTTTTGTAGAGATGG - Intronic
1146411387 17:32588777-32588799 AGGCTAATTTTTAGTAGAGATGG - Intronic
1146505710 17:33403047-33403069 AATCTGATTATTAGTAGAGATGG - Intronic
1146823827 17:36006496-36006518 CAGCTAATTTTTATTAGAGATGG + Intergenic
1146858238 17:36273162-36273184 TGGCTAATTTTTAGTAGAGATGG + Intronic
1147088558 17:38077225-38077247 TGGCTAATTTTTAGTAGAGATGG + Intergenic
1147108652 17:38243298-38243320 TGGCTAATTTTTAGTAGAGATGG - Intergenic
1147654304 17:42080134-42080156 CAGCTAATATTCTGGAGAGACGG - Intergenic
1147753752 17:42754464-42754486 CAGATAATTTTTTGTAGAGATGG + Intergenic
1147846632 17:43408904-43408926 CAGCTAATTTTTAGTAGAGATGG + Intergenic
1147889290 17:43705720-43705742 CCGCAGATGTTTGGGAGAGAGGG - Intergenic
1147932531 17:43991659-43991681 CAGCCAATTTTTTGTAGAGATGG - Intronic
1147937051 17:44017960-44017982 CAGCTAATTTTTAGTAGAGATGG - Intronic
1147941457 17:44051232-44051254 TGGCTAATTTTTAGTAGAGACGG - Intronic
1148058005 17:44813228-44813250 CAACTAATTTTTAGTAGAGATGG + Intronic
1148420802 17:47544873-47544895 TGGCTAATTTTTAGTAGAGATGG + Intronic
1148604245 17:48916814-48916836 CAGTTAATTTTTAGTAGAGATGG - Intronic
1148620097 17:49027998-49028020 CAGCTAATTTTTTGTAGACATGG - Intronic
1148811829 17:50297837-50297859 TGGCTAATTTTTAGTAGAGATGG - Intergenic
1148911975 17:50947683-50947705 CTGCTGTGTTTTTGGAGAGAGGG - Intergenic
1149261740 17:54887576-54887598 CAGCTAAGTTTTAGTAGAGATGG - Intergenic
1149662666 17:58343374-58343396 TAGCTAATTTTTTGTAGAGATGG + Intergenic
1149791422 17:59480895-59480917 TGGCTGATTTTTTGTAGAGATGG - Intergenic
1150020709 17:61609529-61609551 CAGCTAATTTTTAGTAGAGATGG - Intergenic
1150227027 17:63529861-63529883 AAGCTGCTTATTAGGAGATAAGG - Intronic
1150359831 17:64522021-64522043 TAACTTATTTTTAGTAGAGATGG + Intronic
1150461285 17:65355764-65355786 CACCTAATTTTTTGTAGAGATGG + Intergenic
1150754407 17:67898197-67898219 TGGCTAATTTTTAGTAGAGATGG - Intronic
1150756295 17:67917293-67917315 CAGCTTAGTTTTAGTAGAGATGG + Intronic
1150780867 17:68120970-68120992 CAGCTAATTTTTTGTAGAGATGG - Intergenic
1150879680 17:69009734-69009756 CTGGTGTTTTGTAGGAGAGATGG + Intronic
1150913657 17:69414091-69414113 CGGCTAATTTTTAGTAGAGACGG - Intergenic
1150938359 17:69661831-69661853 CAGGTGATTTTTAGGACTGAAGG + Intergenic
1151441648 17:74133172-74133194 CAGCTATTTTTTTGTAGAGATGG - Intergenic
1151523745 17:74649313-74649335 CATTTTATTTTTAGTAGAGACGG + Intergenic
1151612249 17:75183630-75183652 CGGCTAATTTTTCGTAGAGACGG + Intergenic
1151631916 17:75316801-75316823 CAGCTAATTTTTGGTAGAGATGG + Intergenic
1151650059 17:75461749-75461771 CAGCTAATTTTTAGTAGAGACGG - Intronic
1152073589 17:78145956-78145978 CGGCTGATTTTTAGTAGAGATGG + Intergenic
1152150836 17:78600038-78600060 CAGTTAATTTTTTGTAGAGACGG + Intergenic
1152219781 17:79056978-79057000 CAGCTAACTTTTTGTAGAGATGG - Intergenic
1152700662 17:81817282-81817304 TGGCTAATTTTTAGTAGAGATGG - Intergenic
1153090040 18:1332588-1332610 CTGCTAATTTTTAGTAGAGACGG + Intergenic
1153170586 18:2311592-2311614 CAGCTAATTTTTTGTAGAGATGG - Intergenic
1153531245 18:6048624-6048646 CGGCTAATTTTTAGTAGAGACGG - Intronic
1153649313 18:7225464-7225486 TGGCTAATTTTTAGTAGAGAGGG + Intergenic
1154301035 18:13192735-13192757 AAGCTAATTTTTAGTAGAGATGG + Intergenic
1154479815 18:14809172-14809194 CATTTGATTTTGAGGTGAGATGG + Intronic
1154969907 18:21397360-21397382 CGGCTAATTTTTGGTAGAGACGG - Intronic
1155045707 18:22101339-22101361 CAGCTAATTTTTTGTAGAGAGGG + Intergenic
1155206588 18:23563582-23563604 CAGCTAAGTTTTTGTAGAGATGG + Intronic
1155265881 18:24092911-24092933 CAGCTAATTTTTTGTAGAAATGG - Intronic
1155468438 18:26165078-26165100 AAGTTAATTTTTAGGAGAGACGG + Intronic
1155574944 18:27234405-27234427 CAGCTAATTTTTTGTGGAGAGGG + Intergenic
1155647412 18:28095645-28095667 CAGCTAATTTTTAGTGGCGATGG - Intronic
1156059395 18:33055497-33055519 CCGCTAATTTTTTGCAGAGATGG + Intronic
1156951067 18:42898229-42898251 TAGCTAATTTTTAGTAGAGGTGG - Intronic
1157645172 18:49261498-49261520 TGGCTAATTTTTAGTAGAGACGG - Intronic
1157673236 18:49548642-49548664 TGGCTAATTTTTAGTAGAGATGG - Intergenic
1157787114 18:50493947-50493969 CATCTAATTTTTTGTAGAGATGG + Intergenic
1158496946 18:57964274-57964296 TGGCTTATTTTTAGTAGAGATGG - Intergenic
1158685250 18:59607911-59607933 CAGCTAATTTTTAGTAGAGACGG - Intronic
1158733963 18:60058285-60058307 CAGCTAATTTTTTGTAGAGATGG - Intergenic
1158738817 18:60115517-60115539 CAGTTAATTTTTTGTAGAGATGG + Intergenic
1159191033 18:65042900-65042922 CAGCTAATTTTTTGGGGGGAGGG + Intergenic
1159249145 18:65850972-65850994 CAGCTAATTGTTTGTAGAGATGG + Intronic
1159522559 18:69544956-69544978 CAGCTAATTTTTTGTAGAGATGG - Intronic
1159550689 18:69893413-69893435 TAACAGATTTTTAGGAGATATGG - Intronic
1159920159 18:74220626-74220648 TGGCTAATTTTTAGTAGAGATGG - Intergenic
1159956903 18:74525100-74525122 CAGCTAATTTTTTGTAGAGATGG + Intergenic
1160132467 18:76238687-76238709 TGGCTAATTTTTAGTAGAGACGG + Intergenic
1160204155 18:76819782-76819804 CAGCTAATTTTTTGTAGAGATGG + Intronic
1160546234 18:79657783-79657805 CAGCTGCATCTCAGGAGAGACGG + Intergenic
1160606046 18:80050124-80050146 CAGCTGCCTTGAAGGAGAGAGGG + Intronic
1160846260 19:1167535-1167557 CTGCTGGCTTTTAGGAGGGAGGG - Intronic
1160924288 19:1535710-1535732 CAGCTAATTTTTTGTAGAGATGG - Intergenic
1161099534 19:2414702-2414724 CAGCTAATTTTTAGTATAGATGG - Intronic
1161109435 19:2461141-2461163 CAGCTAATTTTTGCTAGAGACGG + Intergenic
1161111087 19:2470525-2470547 CGGCTAATTTTTAGTAGAGATGG - Intergenic
1161148328 19:2693118-2693140 CGGCTAATTTTTTGTAGAGATGG - Intronic
1161408944 19:4105832-4105854 CTGCTAATTTTTTGTAGAGACGG + Intronic
1161566032 19:5003316-5003338 CAGCTAATTTTTATTAGAGATGG - Intronic
1161611135 19:5243640-5243662 CGGCTAATTTTTAGTAGAGATGG + Intronic
1161697510 19:5777710-5777732 TGGCTAATTTTTAGTAGAGACGG - Intronic
1161995656 19:7709901-7709923 CGGCTAATTTTTGGTAGAGACGG + Intergenic
1162122783 19:8482133-8482155 CGGCTAATTTTTAGTAGAGACGG + Intronic
1162134942 19:8549673-8549695 CGGGTAATTTTTAGTAGAGAGGG + Intronic
1162258924 19:9516782-9516804 CAGCTAATTTTTAGTAGAGATGG - Intergenic
1162337071 19:10068344-10068366 CAGCTAATTTTTTGTAGAGATGG - Intergenic
1162521893 19:11185866-11185888 CAGGTAATTTTTTGTAGAGATGG - Intronic
1162566947 19:11449703-11449725 TGGCTAATTTTTAGTAGAGATGG + Intronic
1162640131 19:12001996-12002018 CTGCTAATTTTTAGTAGAGACGG - Intergenic
1162863771 19:13528131-13528153 CAGCTAACTTTTTGTAGAGATGG + Intronic
1162906575 19:13827428-13827450 TGGCTGATTTTTGGGAGAGACGG - Intronic
1163052648 19:14696006-14696028 CGGCTAATTTTTGGTAGAGATGG - Intronic
1163057066 19:14728048-14728070 CGGCTAATTTTCAGTAGAGATGG - Intronic
1163823551 19:19510282-19510304 CAGTTAATTTTCAGTAGAGATGG + Intergenic
1163866713 19:19779232-19779254 CAGCTAATTTTTAGTAGAGACGG + Intergenic
1164036772 19:21462818-21462840 CTTTTGATTTTTAGTAGAGACGG - Intronic
1164776232 19:30855733-30855755 AAGTTGAATTCTAGGAGAGATGG + Intergenic
1164852236 19:31493632-31493654 AAGATCATTTTTAGTAGAGACGG + Intergenic
1165014907 19:32873785-32873807 CTGCTGATTTTGGGGAAAGAGGG + Intergenic
1165109762 19:33495333-33495355 CGGCTAATTTTTAGTAGAGATGG - Intronic
1165352103 19:35281208-35281230 CTGCTGTGTTTTAGGGGAGATGG + Intronic
1165401169 19:35601267-35601289 TGTCTGAGTTTTAGGAGAGAGGG - Intergenic
1165732941 19:38158068-38158090 TGGCTAATTTTTAGTAGAGATGG - Intronic
1165735461 19:38172937-38172959 CAGCTAATTTTTTGTAGACATGG - Intronic
1165740183 19:38200523-38200545 CATCTGTTTTTTAAGAGACAGGG - Intronic
1165815742 19:38641014-38641036 CAGCTTATTTTTTTGAGACAAGG - Intergenic
1166013027 19:39957984-39958006 TAGCTGATTTTTTGTAGAGATGG - Intergenic
1166079482 19:40434600-40434622 CGGCTAATTTTCAGTAGAGACGG + Intergenic
1166112535 19:40631499-40631521 CAGCTACTTTTTTGTAGAGATGG - Intergenic
1166227453 19:41405447-41405469 CAGCTAATTTTTTGTAGGGATGG + Intronic
1166540527 19:43602380-43602402 CAGCTAATTTTTTGTAGAGATGG + Intronic
1166586916 19:43957341-43957363 TGGCTAATTTTTAGTAGAGACGG + Intronic
1166717172 19:44976023-44976045 CAGCTAATTTTTTGTAGAGATGG + Intronic
1167190432 19:47984902-47984924 CGGCTAATTTTTAGTAGAGACGG - Intronic
1167527005 19:49990541-49990563 CAGCCGATTTTTTGTAAAGATGG + Intronic
1167753634 19:51396110-51396132 TAGCTGATTTTTAGTAGAGACGG - Intergenic
1167947426 19:52999978-53000000 CAGCTAATTTTTAGTGGAAACGG - Intergenic
1167955003 19:53057583-53057605 CGGCTAATTTTTAGTAGAGACGG + Intergenic
1168088332 19:54064630-54064652 CAGCTAATTTTTTGTAGAGATGG + Intergenic
1168532690 19:57142310-57142332 CAGCTAATTTTTTGTAGAGACGG + Intronic
1168671617 19:58245108-58245130 CAGCTAATTTTTTGTAGAGATGG + Intronic
924994046 2:340668-340690 GAGCTGATTCCAAGGAGAGAGGG - Intergenic
925166949 2:1721662-1721684 CGGCTAATTTTTAGTAGAGACGG - Intronic
925989233 2:9240414-9240436 AAGCTAATTTTTTGTAGAGATGG + Intronic
926033811 2:9617762-9617784 CAGCTGATTTTTTAGAGATGGGG - Intronic
926126402 2:10274862-10274884 TAGCTAATTTTTAGTAGAGACGG - Intergenic
926253879 2:11173158-11173180 CAGCCAATTTTTTGTAGAGAGGG + Intronic
926405413 2:12547597-12547619 CAGCACATTTTTAGAAGACAAGG + Intergenic
926616124 2:14998433-14998455 CAGCTGACTCCTAGGAGACAGGG - Intergenic
926678385 2:15645744-15645766 CAGCTAATTTTTTGTAGAGATGG - Intergenic
926859564 2:17294080-17294102 CGGCTAATTTTTTGTAGAGATGG - Intergenic
927547788 2:23970119-23970141 CAGCTAATTTTTTGTAGAGATGG - Intronic
927775709 2:25901218-25901240 CGGCTAATTTTTAGTAGAAATGG + Intergenic
927886123 2:26720090-26720112 CGGCTAATTTTTAGTAGAGACGG - Intronic
927919006 2:26957012-26957034 CGGCTAATTTTTAGTAGAGACGG + Intergenic
928077925 2:28282027-28282049 CAGCTGAGCTTTGGGAGTGAGGG + Intronic
928109250 2:28493356-28493378 TGGCTAATTTTTAGTAGAGATGG + Intronic
928146874 2:28786610-28786632 CAGCGAATTTTTAGTAGAGATGG - Intronic
928163869 2:28955232-28955254 TTGCTGATTCTTAGGAGAGCTGG + Intergenic
928170764 2:29001661-29001683 CGGCTAATTTTTAGTAGAGATGG + Intronic
928706769 2:33957916-33957938 CAGCTAATTTTTAGTAGAGACGG + Intergenic
929155981 2:38789029-38789051 TGGCTAATTTTTAGTAGAGACGG - Intergenic
929161071 2:38832706-38832728 TGGCTAATTTTTAGTAGAGATGG + Intronic
929186391 2:39099885-39099907 CTGCTAATTTTTAGTAGAGATGG + Intronic
929509438 2:42555290-42555312 CGGCTAATTTTTAGCAGAGATGG - Intronic
929512328 2:42574295-42574317 CGGCTAATTTTTAGCAGAGATGG + Intronic
930060011 2:47280431-47280453 CAGCTAATTTTTTGTAGAGATGG + Intergenic
930500759 2:52214418-52214440 TGGCTAATTTTTAGTAGAGACGG + Intergenic
930608286 2:53514715-53514737 CAGCTAATTTTTTGTAGAGATGG - Intergenic
930786120 2:55273072-55273094 CGGCTAATTTTTAGTAGAGACGG - Intergenic
930810303 2:55533530-55533552 CAGCTAATTTTTAGTAGAGATGG - Intronic
930891542 2:56394271-56394293 CAGGTGTTGTTTAGGAGGGAAGG - Intergenic
931091659 2:58893134-58893156 GAGCAGATTTTTAGTAGAGACGG + Intergenic
931238776 2:60434162-60434184 CGGCTAATTTTTTGTAGAGATGG - Intergenic
931273628 2:60724539-60724561 TGGCTCATTTTTAGTAGAGATGG - Intergenic
931273942 2:60727367-60727389 CACCTGACGTTTTGGAGAGACGG - Intergenic
931294414 2:60907471-60907493 CAGCCAATTTTTTGTAGAGATGG - Intronic
931375426 2:61703465-61703487 CAGCTAATTTTTTGTAGAGATGG - Intergenic
931428521 2:62192210-62192232 CAGCTAATTTTTAGTAAATATGG + Intergenic
931607037 2:64062905-64062927 TAGCTAATTTTTTGTAGAGATGG + Intergenic
931925460 2:67067481-67067503 CAGCTGATTCCTAGGAGAAATGG - Intergenic
932043168 2:68320461-68320483 CAGCTGACTTTTGGAAGCGAGGG + Intergenic
932604623 2:73156866-73156888 GACCTGATTTCTTGGAGAGAAGG - Intergenic
932696574 2:73961858-73961880 TTTCTGATTTTTAGTAGAGATGG - Intergenic
932704276 2:74011063-74011085 CAGATAATTTTTAGTAGAGACGG - Intronic
933504849 2:83163657-83163679 CGGCTAATTTTTTGTAGAGACGG + Intergenic
933505023 2:83165936-83165958 TTGCTCATTTTCAGGAGAGAAGG - Intergenic
933669428 2:84992790-84992812 TGGCTGATTTTTTGTAGAGACGG + Intronic
933693641 2:85198696-85198718 CAGCTAATTTTTTGTAGAGACGG - Intronic
933735738 2:85492568-85492590 CAGCTAATTTTTGGTAGAGATGG + Intergenic
933865967 2:86517856-86517878 CAGCTAGTTTTTTGTAGAGATGG - Intronic
934687214 2:96330079-96330101 CAGCTAATTTTTTGTAGAGACGG - Exonic
934757801 2:96836547-96836569 CAGCTAATTTTTTATAGAGATGG + Intronic
934782628 2:96981576-96981598 TGGCTGATTTTTAGTAGAGATGG - Intronic
934782905 2:96984130-96984152 CAGCTAATTTTTAGTAGTGATGG + Intronic
935042748 2:99449100-99449122 TGGCTGATTTTTTGTAGAGATGG - Intronic
935067082 2:99658518-99658540 TAGTTGTTTTTTAGTAGAGATGG + Intronic
935164289 2:100556157-100556179 CAGCTAATTTTTTGTAGAGATGG - Intergenic
935169664 2:100601236-100601258 TTTCTGATTTTTAGTAGAGACGG + Intergenic
935192189 2:100787054-100787076 AAGCTGATCTCTAGAAGAGAAGG + Intergenic
935663045 2:105486369-105486391 CAGTTGATTTTGAGAAGAGAAGG + Intergenic
935682313 2:105648455-105648477 AGGCTAATTTTTAGTAGAGATGG - Intergenic
935797791 2:106662360-106662382 CAGCTAATTTTTAGTAGAGACGG + Intergenic
935895162 2:107728795-107728817 CAGCTAATTTTTACTAGAGGCGG + Intergenic
936025091 2:109025633-109025655 CGGCTAATTTTTAGTAGAGACGG - Intergenic
936411874 2:112266238-112266260 CAGCTAATTTTTGGTAAAGACGG - Intergenic
937054339 2:118919767-118919789 CAGCTAATTTTTAGTAGAGATGG - Intergenic
937292342 2:120789192-120789214 TGGCTGATTTTTAGTAGAGACGG + Intronic
937947089 2:127350017-127350039 CAGCTAATTTTCTGTAGAGATGG + Intronic
938302313 2:130225462-130225484 CGGCTAATTTTTAGTAGAGTCGG - Intergenic
938612047 2:132958050-132958072 CAACTGATTGGTAGGAGAAAAGG - Intronic
938813582 2:134876942-134876964 CAGTGTATTTTTAGTAGAGATGG + Intronic
939944333 2:148390733-148390755 CAGCTAAATTTTTGTAGAGATGG + Intronic
939962368 2:148576499-148576521 CATTTGATTCATAGGAGAGATGG - Intergenic
939977360 2:148733659-148733681 CAGCTGTTTTTTTGTAGTGATGG + Intronic
941207045 2:162586459-162586481 CATCAGATTTTGAGGGGAGATGG - Intronic
941390488 2:164907434-164907456 CGGCTAATTTTTTGTAGAGACGG + Intronic
941710283 2:168704767-168704789 CGGCTAATTTTTAGTAGAGACGG + Intronic
941805320 2:169706661-169706683 CAGCTACTTTTTAGTAGAGATGG - Intronic
941868050 2:170355050-170355072 CTGCTGCTTTTTTGGAGAGATGG - Intronic
941990474 2:171551117-171551139 CAGCTAATTTTTTGTAGAGATGG + Intronic
942335944 2:174885639-174885661 CAGCTAATATTTAGTAGAGTTGG + Intronic
942465368 2:176202374-176202396 CAGCTAATTTTTTGTAGAGATGG + Intergenic
942719277 2:178931993-178932015 CAGCTAATTTTTAGTAGAGACGG - Intronic
942726491 2:179013793-179013815 TGGCTAATTTTTAGTAGAGATGG - Intronic
942867507 2:180692987-180693009 CAGCCAATTTTTAGTAGAGATGG - Intergenic
943749473 2:191496417-191496439 TAGCTAATTTTTAGTAGACATGG - Intergenic
944245346 2:197524931-197524953 TGGCTGATTTTTTGTAGAGATGG + Intronic
944686788 2:202124740-202124762 CAGATGATATTCTGGAGAGAAGG - Intronic
944951993 2:204762282-204762304 CAGCTAATTTTTTGTAGAGATGG + Intronic
945611787 2:212012913-212012935 CTGTTGATTTTTTGTAGAGACGG + Intronic
945705561 2:213227083-213227105 CAGCTGCTATTTAGTAGAAAAGG + Intergenic
946003722 2:216505300-216505322 CGGCTAATTTTTAGTAGAGATGG + Intronic
946198682 2:218056913-218056935 TGGCTAATTTTTAGTAGAGACGG - Intronic
946358229 2:219202390-219202412 CGGCTAATTTTTAGTAGAGATGG - Intronic
946811847 2:223534025-223534047 CAGCTGATTTATAGGTAAGGTGG - Intergenic
946907854 2:224433224-224433246 CGGCTAATTTTTAGTAGAGACGG + Intergenic
946922783 2:224596847-224596869 CAGGGTATTTTTAGTAGAGACGG + Intergenic
947159879 2:227202570-227202592 CGGCTAATTTTTTGTAGAGACGG - Intronic
947201815 2:227620993-227621015 CTTCTTATTTTTAGTAGAGACGG + Intronic
947214448 2:227737159-227737181 TAGCTAATTTTTTGTAGAGATGG + Intergenic
947599569 2:231437715-231437737 CAGCTAATTTTTAGTAGAGATGG - Intergenic
947760585 2:232600777-232600799 CAGCTAATTTTTAGTAGAGAAGG + Intergenic
947775345 2:232704565-232704587 CAGCTAATTTTTAGTAGAAATGG + Intronic
948020538 2:234729750-234729772 TGGCTAATTTTTAGGAGAGATGG + Intergenic
948334017 2:237193806-237193828 CATCTGGGTTTTAGGGGAGAGGG + Intergenic
948827848 2:240582096-240582118 CAGGTGATTATTCCGAGAGATGG - Intergenic
1168911011 20:1446719-1446741 CAGGTGGTTTGGAGGAGAGAAGG - Intronic
1168976582 20:1970666-1970688 CAGAGGATTTTTAGGACAGTGGG + Intergenic
1169102513 20:2963429-2963451 CGGCAAATTTTTAGTAGAGATGG - Intronic
1169108356 20:3016575-3016597 TGGCTAATTTTTAGTAGAGACGG - Intronic
1169120364 20:3092323-3092345 CAGCTGATTTTTTTTTGAGACGG - Intergenic
1169223285 20:3839717-3839739 CAGCTAATTTTTTGTATAGATGG - Intergenic
1169581892 20:7032902-7032924 TGGCTAATTTTTAGTAGAGATGG + Intergenic
1169617801 20:7470244-7470266 TGGCTAATTTTTAGTAGAGATGG + Intergenic
1169667904 20:8059219-8059241 CAGCTAATTTTTAGTAGAGATGG + Intergenic
1170057898 20:12227269-12227291 CAGCTAATTTTTAGTAGAGATGG - Intergenic
1170174916 20:13458508-13458530 CAGCTAATTTTTAGTAGAGATGG + Intronic
1170255569 20:14339352-14339374 CAGCTGAATTTTGGGAGGAAAGG + Intronic
1170340357 20:15320036-15320058 CAATTTATTTTTAGTAGAGATGG - Intronic
1170513622 20:17105213-17105235 CAGCAGATCTTCAGGAGACAGGG - Intergenic
1170542392 20:17402498-17402520 TGGCTAATTTTTAGTAGAGACGG - Intronic
1170916739 20:20633648-20633670 CGGCTAATTTTTACTAGAGATGG + Intronic
1171177615 20:23064970-23064992 CTGCTGATTTCTAGGGTAGATGG + Intergenic
1171944062 20:31360317-31360339 CAGCTAATTTTTTGTAGAGATGG - Intergenic
1171962749 20:31506707-31506729 CAGCTAATTTTTATTACAGATGG + Intergenic
1171995617 20:31728647-31728669 CAGCAAATTTTTAGTAGAAATGG - Intergenic
1172341870 20:34164385-34164407 TAGCTAATTTTTTGTAGAGACGG + Intergenic
1172364430 20:34338104-34338126 CAGCTAATTTTTGGTAGAGACGG - Intergenic
1172364675 20:34339849-34339871 CGGCTAATTTTTAGTAGAGACGG + Intergenic
1172384171 20:34521873-34521895 CAGCTAATTTTTTGTAGAGATGG - Intronic
1172396974 20:34614460-34614482 CGGCTAATTTTTTGTAGAGATGG - Intronic
1172573802 20:35991330-35991352 CATATGTTTTTTAGGAGAGCTGG + Intronic
1172673401 20:36649924-36649946 CAGCTAATTTTTAGTAGAGATGG - Intergenic
1172675075 20:36663971-36663993 CGGCTAATTTTTAGTAGAGATGG + Intronic
1172722015 20:37006361-37006383 CAGCTAATTTTTGGTAGAGATGG + Intronic
1173040795 20:39460408-39460430 CAGCTAATTTTTTGCAGAGATGG - Intergenic
1173487473 20:43451873-43451895 CAGCTAATTTTTTTTAGAGATGG - Intergenic
1173657157 20:44707616-44707638 AGGCTGATTTTTAGGGGAGTGGG - Intergenic
1173779341 20:45741483-45741505 CACCCAATTTTTAGTAGAGATGG - Intergenic
1173843048 20:46171380-46171402 TAGCTAATTTTTTGTAGAGATGG - Intergenic
1174005688 20:47408936-47408958 CAGCTAATTTTTTGTAGAGATGG - Intergenic
1174232031 20:49053519-49053541 TGGCTAATTTTTAGTAGAGACGG + Intronic
1174237453 20:49105526-49105548 CGGCTAATTTTTAGTAGAGACGG + Intergenic
1174470044 20:50751516-50751538 TGGCTAATTTTTAGTAGAGACGG + Exonic
1174867363 20:54150494-54150516 CAGCTAATTTTTAGTACAGATGG + Intergenic
1176953910 21:15077814-15077836 CAGCTAATTTTTGGGGGAGTAGG + Intergenic
1177145153 21:17399355-17399377 CAGCTAATTTTTAGTAGAGATGG + Intergenic
1177508921 21:22057369-22057391 CAGGTAATTTTTTGTAGAGATGG + Intergenic
1177581126 21:23022545-23022567 CTGCTACTTTGTAGGAGAGATGG + Intergenic
1177772139 21:25529008-25529030 GAGCAGATTTTGAGGACAGAAGG + Intergenic
1178316888 21:31574358-31574380 CGGCTAATTTTTTGTAGAGATGG - Intergenic
1178429054 21:32503015-32503037 CAGATGCCTTTGAGGAGAGACGG - Intronic
1178461627 21:32807493-32807515 CGGCTAATTTTTAGTAGAGACGG + Intronic
1179352519 21:40626110-40626132 TTCCTGATTTTTAGGAGGGAAGG + Intronic
1179897790 21:44372331-44372353 CGGCTAATTTTTTGTAGAGACGG - Intronic
1180009168 21:45038520-45038542 CGGCTAATTTTTAGTAGAGACGG - Intergenic
1180643390 22:17317676-17317698 CAGCTAATTTTTAATAGAGACGG - Intergenic
1180925631 22:19552493-19552515 CAGCTAATTTTTTGTAGAGATGG + Intergenic
1180969909 22:19809936-19809958 CAGCTAACTTTTTGCAGAGATGG + Intronic
1181518954 22:23434452-23434474 CACCTGATTCCCAGGAGAGATGG + Intergenic
1181538399 22:23559506-23559528 CAGCTAATTTTTGAGAGACAGGG - Intergenic
1181588686 22:23869177-23869199 TAGCTAATTTTTTGTAGAGATGG - Intronic
1181642467 22:24210516-24210538 CAGCTAATATTTTGTAGAGATGG - Intergenic
1181845635 22:25706691-25706713 CAGCTAATGTTTAGTAGAGATGG + Intronic
1181852178 22:25757423-25757445 CCGCTAATTTTTTGTAGAGATGG - Intronic
1181929882 22:26392143-26392165 CAGCTAATTTTTAGTAGAGATGG - Intergenic
1181970780 22:26688259-26688281 CGGCTAATTTTTTGTAGAGACGG - Intergenic
1182274763 22:29180516-29180538 CAGCTAATTTTTTGTAGAGATGG - Intergenic
1182283124 22:29229169-29229191 TAGCTAATTTTTTGTAGAGATGG - Intronic
1182287363 22:29256300-29256322 CAACTAATTTTTAGTAGAGACGG - Intronic
1182304675 22:29359643-29359665 CATCTGATTTTCTGGAGAGTGGG + Intronic
1182329407 22:29540107-29540129 CAGCTAATTTTTAGTAGAGACGG - Intronic
1182384189 22:29922187-29922209 CAGCTAATTTTTAGTAGAGACGG + Intronic
1182524137 22:30905312-30905334 CAGCTAATTTTTAGTAGAAACGG + Intronic
1182717773 22:32372313-32372335 CAGCTAATATTTTGTAGAGATGG + Intronic
1182888888 22:33799601-33799623 CGGCTAATTTTAAGTAGAGACGG + Intronic
1183072341 22:35405186-35405208 CGGCTAATTTTTAGTAGAGATGG + Intronic
1183216737 22:36485448-36485470 CTGCTTTTTTTTAGTAGAGACGG + Intergenic
1183440465 22:37820174-37820196 TGGCTAATTTTTAGTAGAGATGG + Intergenic
1183449641 22:37885764-37885786 CAGCTAATTTTTAGTAGAGATGG + Intronic
1183570907 22:38652712-38652734 AGGCTAATTTTTAGTAGAGACGG - Intronic
1183652778 22:39168349-39168371 CGGCTAATTTTTAGTAGAGATGG - Intergenic
1183737545 22:39652164-39652186 CAGCTAATTTTTAGTAGAGACGG + Intronic
1183846353 22:40544395-40544417 CAGCTCATTTTTTTGAGAGAGGG + Intronic
1183922510 22:41180551-41180573 CTGCTGATTTTTAGTAGAGATGG - Intergenic
1184216774 22:43072783-43072805 CAGCTAATTTTTTTGAGACAGGG + Intronic
1184423222 22:44393845-44393867 CAGCTAATTTTTAGTAGAGACGG - Intergenic
1184456404 22:44612682-44612704 CAGCTAATTTTTAGTAGAGACGG + Intergenic
1184535450 22:45083490-45083512 CGGCTAATTTTTAGTAGAGACGG - Intergenic
1184599711 22:45536010-45536032 CAGCTAATTTTTTGTAGTGATGG - Intronic
1184616776 22:45643815-45643837 CAGCTAATTTTTCATAGAGATGG + Intergenic
1185291404 22:50029566-50029588 CGGCTAATTTTTAGTAGAGATGG - Intronic
949351107 3:3126062-3126084 CGGCTAATTTTTAGTAGAGACGG - Intronic
949467931 3:4362749-4362771 CAGCTAATTTTTTGTAGAGATGG - Intronic
950384553 3:12647428-12647450 TGGCTGATTTTTTGTAGAGATGG - Intronic
951216744 3:20032314-20032336 TGGCTAATTTTTAGTAGAGATGG - Intergenic
951626535 3:24670559-24670581 CAGCCTATTTTTGAGAGAGAAGG - Intergenic
951724879 3:25746549-25746571 CAGCAGATTTTTATGGGAAATGG + Intronic
952144746 3:30519707-30519729 CAGATGAATTTTCTGAGAGAAGG - Intergenic
952278585 3:31901865-31901887 TAGCTGATTTTTACTAGAGATGG - Intronic
952418305 3:33109165-33109187 CTGCTAATTTTTTGTAGAGATGG + Intergenic
952460475 3:33520174-33520196 CAGCTAATTTTTGTTAGAGATGG + Intronic
952467526 3:33605779-33605801 TGGCTAATTTTTAGTAGAGATGG + Intronic
952509311 3:34037689-34037711 CAGCTAATTTTTTGTAGAGAAGG + Intergenic
952802933 3:37314129-37314151 AGGCTAATTTTTAGTAGAGATGG + Intronic
953052983 3:39362483-39362505 CAGCTGCTTTTTGGTAGAGCAGG - Intergenic
953306815 3:41839175-41839197 CAGCTAATTTTTAGTAGAGACGG - Intronic
953514853 3:43579980-43580002 CAGCTAATTTTTTGTAAAGACGG - Intronic
953594591 3:44298291-44298313 CAGCTAATTTTTTGTAGAGATGG - Intronic
953963724 3:47285875-47285897 CAGCTAATTTTTTGTAGAGATGG - Intronic
954006794 3:47597631-47597653 CAGCTAATTTTTTATAGAGATGG + Intronic
954090565 3:48280469-48280491 CAGCTAATTTTTAGTAGAGACGG - Intronic
954116844 3:48471409-48471431 CGGCTAATTTTTAGTAGAGACGG - Intronic
954204186 3:49045760-49045782 CAGCTAATTTTTTGTAGAGATGG + Intronic
954252106 3:49376009-49376031 CAGCTAATTTTTGATAGAGATGG + Intronic
954315722 3:49800353-49800375 CAACTAATTTTTTGTAGAGATGG - Intergenic
954344924 3:49988797-49988819 CAGCTTATTTTTGGCAGAGATGG - Intronic
954769481 3:52953288-52953310 CAGCTAATTTTTAGTAGAGATGG - Intronic
954799316 3:53178106-53178128 CAGCTAATTTTTAGTAGAGATGG + Intronic
954937870 3:54343452-54343474 CAGCTAATTTTTTGTAGAGATGG + Intronic
955309923 3:57875350-57875372 CAGCTAATTTTTTGTAGAGATGG - Intronic
956462844 3:69488728-69488750 CAGCTAATTTTTAGTGGAGATGG - Intronic
956565474 3:70632244-70632266 CAGGTAGTTTTTAGTAGAGATGG + Intergenic
956745299 3:72306369-72306391 CAGCTAATTTTTTGTAGAGGTGG + Intergenic
956755489 3:72381929-72381951 CTGGTGACTTTTAGGAGAGCAGG + Intronic
956769611 3:72513655-72513677 CAGGTAATTTTTTGTAGAGATGG - Intergenic
956948428 3:74252096-74252118 CAGCTAATTTTTTGTAGAGCTGG + Intergenic
957047168 3:75385057-75385079 CAGATGCCTTTGAGGAGAGATGG + Intergenic
957229237 3:77490260-77490282 CAGCTAATTTTTAGTAGAGACGG + Intronic
957382147 3:79445822-79445844 CGGCTAATTTTTAGTACAGACGG + Intronic
957619588 3:82578077-82578099 CGGCTAATTTTTTGTAGAGATGG - Intergenic
957876538 3:86154230-86154252 CAGATGCATTTTAGGAAAGAAGG + Intergenic
958812054 3:98871865-98871887 CAGCTGAATTTTACCAGACATGG - Intronic
959072105 3:101712235-101712257 CGGCTAATTTTTTGTAGAGACGG - Intergenic
959674372 3:109018317-109018339 CAACTGATTATTAGTGGAGAGGG + Intronic
959945256 3:112119210-112119232 TGGCTAATTTTTAGTAGAGATGG - Intronic
959987360 3:112589652-112589674 CAGCTAATTTTTAGTAGAGATGG + Intergenic
960094800 3:113678915-113678937 CGGCTAATTTTTTGTAGAGATGG + Intronic
960095821 3:113688866-113688888 CAGCTAATTTTCAGTAGAGACGG - Intronic
961016262 3:123470540-123470562 GGGCTAATTTTTAGTAGAGAGGG + Intergenic
961132859 3:124484931-124484953 CAGCTAATTTTTTGTAGAGACGG - Intronic
961161582 3:124731057-124731079 CAGCTAATTTTTTGTAGAGACGG - Intronic
961680278 3:128595327-128595349 CAGCTAATTTTTAGTAGAGATGG - Intergenic
961726044 3:128931336-128931358 CAGCTAATTTTCTGTAGAGACGG + Intronic
961831302 3:129624291-129624313 CAGCTAACTTTTTGTAGAGATGG - Intergenic
961832352 3:129630083-129630105 CGGCTAATTTTTTGTAGAGATGG - Intergenic
961879239 3:130049153-130049175 CAGATGCCTTTGAGGAGAGATGG + Intergenic
961901270 3:130214221-130214243 AAGAGGATTTTCAGGAGAGAAGG + Intergenic
962393770 3:134996354-134996376 CAGCCAATTTTTTGTAGAGATGG + Intronic
962514333 3:136135873-136135895 CAGCTAACTTTTAGTAGAGATGG - Intronic
962578721 3:136778077-136778099 CAGCTAATTTTTTGTGGAGATGG - Intergenic
962838911 3:139215697-139215719 GAGCTGGTTTTGAGGAGAGAGGG - Intronic
962992520 3:140591914-140591936 CAGAGTATTTTTAGTAGAGACGG - Intergenic
963774203 3:149421796-149421818 CAGATGATTCTTGGCAGAGAAGG - Intergenic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964219976 3:154331977-154331999 CAGCTAATTTTTGGTAGAGACGG - Intergenic
964424546 3:156537537-156537559 CAGCTGATTTATGAAAGAGAGGG + Exonic
964832007 3:160894508-160894530 CAAATAATTTTTAGGAAAGAAGG + Intronic
965164689 3:165181850-165181872 CACCTGATTGTGTGGAGAGATGG - Intergenic
965204182 3:165699694-165699716 CAGCTAATTTTTAGTAAAGACGG - Intergenic
965558642 3:170041462-170041484 CGGCTAATTTTTAGTAGAGACGG + Intronic
965799389 3:172476143-172476165 CATCCTATTTTTAGGAAAGATGG + Intergenic
965956790 3:174379706-174379728 TTTCTGATTTTTAGTAGAGATGG - Intergenic
966158835 3:176947107-176947129 CAGCTAATTTTTTGTAGAGATGG - Intergenic
966716146 3:183014874-183014896 CAGCTTATTTTTTGTGGAGACGG + Intergenic
966808082 3:183821706-183821728 CAGCTAATTTTTAGTAGAGATGG + Intronic
966985782 3:185179124-185179146 CAGCTAATTTTTAGTAGAGATGG - Intergenic
967028332 3:185583656-185583678 CAGTTAATTTTTAGTAGAGATGG + Intronic
967058271 3:185848954-185848976 CGGCTAATTTTTAGTAGAGATGG + Intergenic
967745875 3:193054300-193054322 CCTCCGATTTATAGGAGAGAGGG + Intergenic
967771607 3:193339957-193339979 CAGATGATTTTACAGAGAGATGG + Intronic
967819773 3:193830314-193830336 CAGCTAATATTTAGTAGAGATGG + Intergenic
967948586 3:194823303-194823325 CAGTTGATTTTGATGAGAGAAGG + Intergenic
968051931 3:195660773-195660795 CAGCTAATTTTTAGTAGAGAGGG + Intergenic
968103881 3:195987565-195987587 CAGCTAATTTTTAGTAGAGAGGG - Intergenic
968143931 3:196281858-196281880 CAGCTAATTTTTTGTAGAGATGG + Intronic
968146870 3:196306709-196306731 CGGCTAATTTTTAGTAGAGACGG + Intronic
968210803 3:196847179-196847201 TAACTGTTTTTTAGTAGAGACGG + Intergenic
968215278 3:196884110-196884132 CAGCAGATTTTTAAAAGAGCAGG + Intronic
968302183 3:197625158-197625180 CAGCTAATTTTTAGTAGAGAGGG - Intergenic
968361989 3:198153766-198153788 CATCTGGGTTTTTGGAGAGAAGG - Intergenic
968528267 4:1075831-1075853 CAGCTAATTTTTTGTAGAGATGG + Intronic
968580478 4:1389547-1389569 AAGCTTATTTTTGGTAGAGATGG + Intergenic
968796490 4:2709317-2709339 TATATTATTTTTAGGAGAGATGG + Intronic
969124808 4:4939071-4939093 TGGCTAATTTTTAGTAGAGATGG - Intergenic
969823881 4:9741344-9741366 CAGATGCCTTTGAGGAGAGATGG - Intergenic
970094621 4:12448878-12448900 GAGCAGAATTTAAGGAGAGAGGG - Intergenic
970118252 4:12723440-12723462 CAGCTCATTTATAGCAGAGCTGG + Intergenic
970149620 4:13075386-13075408 CAGCTAATTTTTTGTAGAGACGG + Intergenic
970175332 4:13333585-13333607 TAGAGGATTTTAAGGAGAGAGGG - Intergenic
971087740 4:23298667-23298689 AAGCTGATTTTTTGGAGTAAAGG - Intergenic
971308322 4:25502984-25503006 TAGCTAATTTTTTGTAGAGATGG - Intergenic
971491781 4:27219985-27220007 TGGCTAATTTTTAGTAGAGATGG + Intergenic
971571595 4:28218779-28218801 TGGCTAATTTTTAGTAGAGACGG - Intergenic
971778588 4:31000690-31000712 CACATGTTTTGTAGGAGAGAAGG - Intronic
971925026 4:32997519-32997541 CAGCTGATCTTTAGCAGGGTTGG - Intergenic
972194396 4:36636035-36636057 TGGCTAATTTTTAGTAGAGATGG - Intergenic
972562996 4:40245363-40245385 TAGCTAATATTTAGAAGAGACGG - Exonic
972983702 4:44737581-44737603 CATCTGGTTATAAGGAGAGATGG + Intergenic
973900281 4:55462447-55462469 CAGCTAATTTTTGGTAGAGATGG + Intronic
975007519 4:69309249-69309271 CAGCTTATCTTTGGGAGAAAAGG - Intronic
975730094 4:77329480-77329502 TGGTTGATTTTTAGTAGAGACGG - Intronic
976022620 4:80647892-80647914 CAGCTAATTTTTAGTAGAGATGG - Intronic
976169757 4:82291071-82291093 CAGCTAATTTTTTGTAGAGATGG - Intergenic
976368427 4:84258370-84258392 CATCTTATTTTTAATAGAGAAGG + Intergenic
976420179 4:84833504-84833526 TAGCTAATTTTTTGTAGAGATGG - Intronic
976463688 4:85343428-85343450 AAGCTGATTTTTAGGACAGGTGG - Intergenic
976536059 4:86218839-86218861 CAACTGATTTGTAGGGAAGAGGG + Intronic
976627468 4:87202288-87202310 CAACATATTTTTAGTAGAGACGG + Intronic
976819971 4:89195161-89195183 CTGCTGATTTTTAGGCATGAAGG - Intergenic
977075864 4:92448335-92448357 CATCTAACTTTTAGTAGAGATGG + Intronic
977586098 4:98777232-98777254 CAGCTAATTTTTTGTAGAGATGG - Intergenic
977997928 4:103517432-103517454 CAGCTCATTTTTAGTAGATACGG + Intergenic
978029473 4:103921889-103921911 CAGCTAATTTTTTGTAGAGATGG - Intergenic
978120766 4:105076613-105076635 CAGATGAATTTTATGATAGAAGG + Intergenic
978434896 4:108673776-108673798 CAGCTAATTTTTAGTAGAGATGG + Intergenic
978448705 4:108805658-108805680 CAGCTAATTTTTAGCAGAGACGG - Intergenic
978718155 4:111871228-111871250 CAGCTGATTTTCTGTTGAGATGG - Intergenic
978790932 4:112662985-112663007 CAGCTAATTTTTTGTAGAGATGG + Intergenic
979383934 4:120041768-120041790 CAGCTTGTTTTTAGGATAAAAGG - Intergenic
979463284 4:121007221-121007243 CAGTTAATTTTTTGGAGAGACGG - Intergenic
979661031 4:123255352-123255374 TGGCTAATTTTTAGTAGAGACGG - Intronic
979691007 4:123558377-123558399 CATCTTATTTTTTGTAGAGAGGG - Intergenic
980132936 4:128833530-128833552 CAGCTAATTTTTAGTAGAGATGG - Intronic
980466047 4:133183783-133183805 CATTAGAATTTTAGGAGAGATGG + Intronic
980885581 4:138758924-138758946 TAGGTGATTTTTATGGGAGAAGG - Intergenic
981166499 4:141565193-141565215 CAGCTAATTTTTGGTAGAGACGG - Intergenic
981314191 4:143325547-143325569 CAACTAATTTTTTGTAGAGATGG - Intergenic
981449081 4:144874973-144874995 CAGCTAATTTTTAGTAGAGGCGG - Intergenic
982022975 4:151222833-151222855 CAGCTAATTGTTAGTAGAGATGG + Intronic
982457902 4:155631925-155631947 CAGCTAATTTTTAGTAGAGACGG + Intergenic
983246177 4:165290303-165290325 CAGCTAATTTTTTGTAGAGATGG + Intronic
983706586 4:170667520-170667542 GAGCAGATTTGTAGGAGAAATGG + Intergenic
984109662 4:175596542-175596564 CAGCTGATTATTAGGGCAGGGGG - Intergenic
984313962 4:178102362-178102384 CAGCTAATTTTTTGTAGAGATGG - Intergenic
984358473 4:178696373-178696395 CAGCTAATTTTTTGTAGAGATGG - Intergenic
984555375 4:181207974-181207996 CAGCTAATTTTTAGGAGAGATGG + Intergenic
984959351 4:185079783-185079805 CAGCTGACTTTTGGAAAAGAGGG + Intergenic
985250172 4:188016083-188016105 CACCTGTTTTTTAAGAGATAGGG - Intergenic
985498137 5:222508-222530 CAGCTAATTGTTAGTAGAGATGG + Intronic
986049530 5:4076114-4076136 CAGCTAATTTTTTGTAGAGATGG - Intergenic
986104402 5:4645915-4645937 CAGCTAATTTTTTGGAGAGACGG + Intergenic
986183508 5:5416265-5416287 TAACTGATGTTTAGGAGACACGG + Intergenic
986227154 5:5826534-5826556 TGGCTAATTTTTAGTAGAGATGG - Intergenic
986815435 5:11404778-11404800 CGGCTAATTTTTTGTAGAGATGG + Intronic
987309586 5:16669374-16669396 CAGCTAATTTTTTGCAGAGATGG + Intronic
987985670 5:25142291-25142313 CAGCTAATTTTTAGTGGAGACGG + Intergenic
988115006 5:26875635-26875657 CAGCTTATTTTTAGTAGAAGTGG + Intergenic
988569791 5:32352878-32352900 CAGCTCTTTTTTTGTAGAGATGG - Intergenic
989082682 5:37641276-37641298 CAGCTAATTTTTAGTAGACAGGG + Intronic
989138322 5:38177251-38177273 CACCATATTTTTAGTAGAGATGG + Intergenic
989358579 5:40573203-40573225 CTGCTGATGTGGAGGAGAGAAGG - Intergenic
989421528 5:41245357-41245379 CAGCTAATTTTTCATAGAGATGG - Intronic
989616031 5:43337812-43337834 CAGCTAATTTTTAGTAGAGATGG + Intergenic
990087773 5:51999952-51999974 CGGCTAATTTTTTGTAGAGACGG - Intergenic
990438310 5:55817628-55817650 CAGCTAATTTTTAGTAGAGACGG + Intergenic
990469422 5:56100762-56100784 CAGTTAAGTTTCAGGAGAGAAGG - Intronic
990620241 5:57550867-57550889 CAGGTGATTCTTATTAGAGAAGG + Intergenic
991063303 5:62400919-62400941 CAGCCAATTTTTTGTAGAGATGG + Intronic
991726429 5:69540282-69540304 TGGCTAATTTTTAGTAGAGATGG + Intronic
991771704 5:70047014-70047036 CAGCTATTTTTTGGGAGAGAAGG - Intergenic
991850995 5:70922421-70922443 CAGCTATTTTTTGGGAGAGAAGG - Intergenic
991868528 5:71087592-71087614 TGGCTAATTTTTAGTAGAGATGG - Intergenic
992045692 5:72886724-72886746 CAGCTGATTTTTAGGAGAGACGG - Intronic
992103356 5:73428770-73428792 TAGCTAATTTTTTGTAGAGATGG + Intergenic
992133356 5:73718045-73718067 ATTCTGATTTTTAGTAGAGATGG + Intronic
992154517 5:73941718-73941740 CAGCTGATTGATAGAAGTGAGGG - Exonic
992443539 5:76815035-76815057 TGGCTAATTTTTAGTAGAGATGG + Intergenic
992510216 5:77425388-77425410 CAGCTAATTTTTAGTAGAGAAGG - Intronic
992539807 5:77752860-77752882 CGGCTTATTTTTAATAGAGACGG + Intronic
992554353 5:77888865-77888887 TGGCTAATTTTTAGTAGAGACGG + Intergenic
992560057 5:77942675-77942697 CTGCTGATTTTTTGTAGAGACGG - Intergenic
992643111 5:78786780-78786802 CAGCTGATTTTTTATAGAGATGG + Intronic
992711851 5:79466342-79466364 CGGCTAATTTTTTGTAGAGATGG - Intronic
992805612 5:80334525-80334547 CAGCTAATTTTTTGTAGAGATGG - Intergenic
992858526 5:80889162-80889184 CAGCTAATTTTTTGTAGAAACGG - Intergenic
993372690 5:87112004-87112026 TGGCTGATTTTTAAGAAAGAAGG - Intergenic
994386494 5:99139113-99139135 CAGCTAATTTTTGAGAGAGAGGG - Intergenic
994621492 5:102168530-102168552 CAGCTAATTTTTTGTAGAGATGG - Intergenic
994661874 5:102663528-102663550 CAGATTATTTTAAGGATAGAAGG + Intergenic
995093145 5:108204351-108204373 CAGCTAATTTTTTGTAGAGATGG + Intronic
995126970 5:108587778-108587800 CAGCAGATTCTTAAGAGAAAAGG + Intergenic
995415941 5:111913324-111913346 CAGGTGTTTTTCAGGAGATAAGG + Intronic
995516545 5:112959982-112960004 CAGCTAATTTTTGTTAGAGACGG + Intergenic
995793105 5:115915025-115915047 TGGCTAATTTTTAGTAGAGACGG + Intergenic
995873886 5:116770165-116770187 CAGCTAATTTTTTGTAGAGATGG - Intergenic
995890782 5:116948119-116948141 CATCTGCTTCATAGGAGAGAAGG + Intergenic
996153165 5:120064729-120064751 CAGCTAATTTTTAGTAGAGACGG + Intergenic
996573830 5:124961121-124961143 TGGCTAATTTTTAGTAGAGACGG + Intergenic
996812384 5:127531783-127531805 CAGCTAATTTTTGGTAGAGACGG + Intronic
996870889 5:128192335-128192357 CAGCTGGTGTTAAGGGGAGATGG - Intergenic
997144797 5:131421220-131421242 CAGCTAATTTTTTGTAGAGATGG + Intergenic
997500339 5:134368865-134368887 CGGCTAATTTTTTGTAGAGATGG - Intronic
997613774 5:135232591-135232613 CAGCTAATTTTTTGTAGAGAAGG - Intronic
997753938 5:136376945-136376967 CAGATTATCTCTAGGAGAGATGG + Intronic
998268673 5:140686761-140686783 CAGCTAATTTTTAGTAGAGATGG + Intronic
998355655 5:141533866-141533888 CAGCTAATTTTTTGTAGAGATGG - Intronic
998427957 5:142045899-142045921 CAGCTTATCTTTAGTAGAGATGG + Intergenic
998783451 5:145683738-145683760 CACATGAATTGTAGGAGAGAGGG + Intronic
998831774 5:146167564-146167586 CGGCTAATTTTTTGTAGAGATGG + Intronic
999395802 5:151226708-151226730 CGGCTAATTTTTAGTAGAGACGG - Intronic
999518825 5:152329583-152329605 CAGCTGAGATTTTGGAGACACGG + Intergenic
999547011 5:152640753-152640775 CAGCTAATTTTTTGCAGAGATGG - Intergenic
999785956 5:154890924-154890946 CAGCTAATTTTTAGTAGAGACGG + Intronic
999985102 5:156996028-156996050 CAGCTAATTTTTTGTAGAGATGG - Intergenic
1000094928 5:157963253-157963275 CAGCACATTTTTTGTAGAGATGG + Intergenic
1000179572 5:158794917-158794939 CAACTAATTTTTAGGCAAGATGG - Intronic
1000187180 5:158870511-158870533 CAGCTAATTTTTTGTAGAGATGG - Intronic
1000218686 5:159190202-159190224 CAGTTAATTTTTTGTAGAGAAGG + Intronic
1000712551 5:164599254-164599276 CAGCTAATTTTTTGTAGAGCTGG + Intergenic
1000718418 5:164676593-164676615 CAGCTTATTTTAAGGAAAGAGGG - Intergenic
1001117214 5:168949760-168949782 CAGCTAATTTTTTGTAGAAATGG + Intronic
1001393156 5:171396808-171396830 CAGCTGTATGTTAGCAGAGACGG - Intronic
1001581402 5:172800973-172800995 CATTTTATTTTTAGTAGAGAGGG - Intergenic
1001791726 5:174463498-174463520 CAGCTAATTTTTAATAGAGATGG + Intergenic
1001877341 5:175213013-175213035 CAGCTAATTTTTTGTAGACATGG + Intergenic
1002018947 5:176349507-176349529 CAGCTGATTTTTAGTAGAGATGG - Intronic
1002107243 5:176886064-176886086 CAGCTCATTTTTAGTAGAGATGG - Intronic
1002130504 5:177078608-177078630 CAGCTTATTTTTATTAGAGACGG - Intronic
1002525073 5:179811068-179811090 CGGCTAATTTTTAGTAGAGACGG - Intronic
1003536034 6:6976249-6976271 CAGCTAATTTTTTGCAGAGTTGG - Intergenic
1003593385 6:7454365-7454387 CAGCTGATTTTTTGTAGAGATGG - Intergenic
1003904768 6:10689138-10689160 TGGCTAATTTTTAGTAGAGACGG + Intronic
1003944166 6:11058358-11058380 CAGCTAATTTTTTGTAGAGATGG + Intergenic
1004204629 6:13580829-13580851 CAGCTACTTTTTTGTAGAGATGG + Intronic
1004218044 6:13720385-13720407 CGGCTAATTTTTAGTAGAGACGG - Intergenic
1004288696 6:14346825-14346847 CAACTGATTTATAGGAGTGGGGG - Intergenic
1004675819 6:17841233-17841255 CAGCTAATGTTTTGTAGAGAAGG + Intronic
1004908404 6:20259041-20259063 CAGCTAATTTTTAGTAGAGATGG - Intergenic
1005060423 6:21771873-21771895 CAGAGGAATGTTAGGAGAGAGGG + Intergenic
1005299591 6:24457708-24457730 CAGCTAATTTTTAGTAGAGACGG - Intronic
1005462573 6:26083123-26083145 CAGCTCTTTTTTTGGAGACAGGG + Intergenic
1005517822 6:26571319-26571341 CGGCACATTTTTAGTAGAGACGG - Intergenic
1005627742 6:27679428-27679450 CGACTAATTTTTAGTAGAGACGG - Intergenic
1005664241 6:28034460-28034482 CAGGTGATTTTTATTAGAGCTGG - Intergenic
1005736818 6:28755611-28755633 CAGCTAATTTTTAGTAGAGGTGG - Intergenic
1005889411 6:30124510-30124532 CAGCTGTCTTGCAGGAGAGAAGG - Intergenic
1005955112 6:30658232-30658254 CAGCTAATTTTTAGTAGAGATGG - Intronic
1005970159 6:30754492-30754514 TGGCTAATTTTTAGTAGAGACGG - Intergenic
1005971064 6:30762279-30762301 CAGGTAATTTTTTGTAGAGATGG + Intergenic
1006033160 6:31192520-31192542 CGGCTAATTTTTAGTAGAGATGG + Intergenic
1006095492 6:31653686-31653708 TAGCTTATTTTTTTGAGAGAGGG + Intronic
1006120145 6:31799359-31799381 CAGCTGATTTTTTTTTGAGATGG + Intronic
1006490097 6:34379842-34379864 CGGCTAATTTTTAGTAGAGATGG - Intronic
1006769853 6:36543802-36543824 CAGCTAGTTTTTAGTAGAGACGG + Intronic
1007266477 6:40600026-40600048 CAACTGATTTATAGGAGACCAGG - Intergenic
1007617811 6:43192221-43192243 CAGATAATTTTTTGTAGAGATGG + Intronic
1008403491 6:51092251-51092273 TAGTTGTTTTTTTGGAGAGAAGG + Intergenic
1008757330 6:54811927-54811949 CAGTTGATTTTTAAAAGATAGGG + Intergenic
1009311401 6:62157181-62157203 CTACTTATTTTTAGTAGAGACGG - Intronic
1009473480 6:64057992-64058014 CAGCTAATTTTTCGTAGAGACGG + Intronic
1009665976 6:66680280-66680302 TGGCTAATTTTTAGTAGAGATGG + Intergenic
1009837988 6:69029395-69029417 CAGCAACTGTTTAGGAGAGAGGG + Intronic
1009989677 6:70826591-70826613 CAGCTAATTTTTTGTAGAGATGG - Intronic
1010687913 6:78873639-78873661 CAGCTAATTTTTTATAGAGACGG + Intronic
1011164406 6:84430267-84430289 CAACTGATCTTCAGCAGAGAAGG + Intergenic
1011350909 6:86422804-86422826 CTGATGATTTTTAAGAGAGTAGG + Intergenic
1011424596 6:87213011-87213033 CAGCAGATTAATAGGAGAAATGG + Intronic
1011638341 6:89396587-89396609 GAGCTAATTTTTTGTAGAGATGG + Intronic
1011727329 6:90223472-90223494 CAGCTGACTTTTTTGAGACAGGG + Intronic
1012029447 6:94038977-94038999 AAAATGATTTTTAGGAGAAATGG + Intergenic
1012583203 6:100893045-100893067 CAGTTAATTTTTATGTGAGAGGG + Intergenic
1012781327 6:103561542-103561564 CAGCTGATTTTTGACAGAGAAGG - Intergenic
1012947804 6:105486684-105486706 CAGCTGACTTTTAGAACAGAGGG - Intergenic
1013060158 6:106625824-106625846 TGGCTAATTTTTAGTAGAGACGG + Intronic
1013217426 6:108040469-108040491 TGGCTAATTTTTAGTAGAGAAGG + Intergenic
1013329559 6:109086186-109086208 CAGCTAGTTTTTAGTAGAGATGG - Intronic
1013524898 6:110964802-110964824 CGGCTAATTTTTAGTAGAGACGG + Intronic
1013838175 6:114357739-114357761 CTATTCATTTTTAGGAGAGAAGG - Intergenic
1014541162 6:122678068-122678090 CGGCTAATTTTTTGTAGAGACGG + Intronic
1015168627 6:130226654-130226676 CAGCTTATTTTTAGTAGAGACGG - Intronic
1015741060 6:136454467-136454489 CAGCTAATTTTTGGTAGAGATGG + Intronic
1015942596 6:138466911-138466933 TAGTAGATTTTTAGTAGAGACGG - Intronic
1016273091 6:142313491-142313513 TCACTGATTTTCAGGAGAGAAGG - Intronic
1016504317 6:144761482-144761504 CAGCTAATTTTTTGTAGAGATGG - Intronic
1016755175 6:147677099-147677121 CTGCTGATGTTTAGGAGTGGAGG + Intronic
1016847907 6:148587423-148587445 CAGCTGCTTTTTGGTAGAGCAGG + Intergenic
1016955448 6:149622289-149622311 CGGCTAATTTTTAGTAGAGATGG + Intronic
1016956509 6:149632219-149632241 CACCTGTATTTTAGTAGAGACGG - Intronic
1017149009 6:151261215-151261237 CAGCTAATTTTTAGTAGAGATGG - Intronic
1017179208 6:151534225-151534247 CAGCTAATTTTTTGTAGAGATGG + Intronic
1017347254 6:153398453-153398475 CAGCTAATTTTTTGTAGAGATGG - Intergenic
1017366961 6:153654572-153654594 CAGCTAATTTTTTGTACAGAGGG - Intergenic
1017513306 6:155133182-155133204 CAGCTAATTTTCATTAGAGATGG - Intronic
1017524873 6:155233789-155233811 CTTTTGATTTTTAGTAGAGAAGG - Intronic
1017545512 6:155447205-155447227 CAGCTAATTTTTAGTAGAGATGG + Intronic
1017560152 6:155618385-155618407 CGGCTAATTTTTTGTAGAGATGG - Intergenic
1017831356 6:158133134-158133156 CAGCTAATTTTTTGTAGAGATGG - Intronic
1018074827 6:160202532-160202554 CAGCTGATTTTGCAGAGGGAGGG - Intronic
1018197376 6:161367151-161367173 CGGCTAATTTTTAGTAGAGACGG + Intronic
1018415366 6:163596997-163597019 CAGATGAGTACTAGGAGAGAGGG + Intergenic
1018431650 6:163727403-163727425 TGGCTAATTTTTAGTAGAGATGG + Intergenic
1018627760 6:165796256-165796278 CAGCTAATTTTTTGTAGAGATGG + Intronic
1018978189 6:168581705-168581727 AAGCTGATGTTTAGGTGGGATGG + Intronic
1019253689 7:34941-34963 CATCTGGGTTTTTGGAGAGAAGG + Intergenic
1019522041 7:1465456-1465478 CAGTGCATTTTTAGTAGAGACGG + Intergenic
1019692003 7:2420634-2420656 CAGCTAATTTTTTGTAGAGATGG - Intronic
1019799379 7:3077182-3077204 CGGCTAATTTTTAGTAGAGATGG + Intergenic
1020113113 7:5458988-5459010 CAGTTAATTTTTTGTAGAGATGG - Intronic
1020170541 7:5841380-5841402 CAGCTAATTTTTAGTAGAGACGG - Intergenic
1020231516 7:6322637-6322659 TGGCTAATTTTTAGTAGAGATGG - Intergenic
1020248723 7:6450318-6450340 CAGCTAATTTTTAGGAGAGACGG - Intronic
1020248848 7:6451033-6451055 CAGCTAATTTTTAGGAGAGACGG - Intronic
1020251469 7:6472061-6472083 CAGCTAATTTTTAGTAGAGATGG + Intronic
1020266448 7:6563517-6563539 TAGCTAATTTTTTGTAGAGATGG - Intergenic
1020314301 7:6894066-6894088 CAGATGCCTTTGAGGAGAGATGG + Intergenic
1020416434 7:7951367-7951389 CAGCTAATTTTTAGTAGAGATGG + Intronic
1020453344 7:8345192-8345214 CAGCTAATTTTTTGTAGAGATGG + Intergenic
1020793657 7:12657377-12657399 CAGCTAATTCTTTGTAGAGATGG + Intergenic
1020826121 7:13031217-13031239 CAGCTGATTTTTGCTAGATATGG - Intergenic
1021127695 7:16872315-16872337 CAGCTGATTTTTAACAAAGGTGG + Intronic
1021380394 7:19959232-19959254 CGGCTAATTTTTAGTAGAGACGG - Intergenic
1021700668 7:23316506-23316528 CAATTTATTTTTAGTAGAGATGG - Intronic
1022501580 7:30885347-30885369 CGGCTAATTTTTAATAGAGATGG - Intronic
1022602181 7:31771881-31771903 CAGCTAATTTTTTGTAGAGACGG - Intronic
1022682850 7:32566337-32566359 CAGCTAATTTTTTGTGGAGATGG + Intronic
1022728470 7:33001370-33001392 CAGCTAATTTTTTGTAGAGACGG - Intronic
1022747581 7:33188461-33188483 CAGCTGATCTTTAATGGAGAAGG + Intronic
1022855340 7:34308862-34308884 AAGCTGAGTTTCAGGAAAGAGGG + Intergenic
1023564441 7:41509728-41509750 CAGTTAATTTTTAGTAGAGACGG + Intergenic
1024157822 7:46643339-46643361 CAGCTAATTTTTTGTGGAGATGG + Intergenic
1024215089 7:47241742-47241764 TGGCTAATTTTTAGTAGAGATGG + Intergenic
1024718908 7:52112451-52112473 CGGCTAATTTTTAGTAGAGATGG - Intergenic
1026246045 7:68620668-68620690 CGGCTAATTTTTAGTAGAGACGG - Intergenic
1026347133 7:69483763-69483785 CAGTTAATTTTTTGAAGAGACGG - Intergenic
1026392500 7:69915887-69915909 TAGCTAATTTTTTGAAGAGATGG + Intronic
1026825261 7:73577806-73577828 CAGCTAATTTTGCGTAGAGATGG + Intronic
1026866256 7:73825840-73825862 CAGCTAATTTTTAGTATAGACGG + Intronic
1026944889 7:74309303-74309325 CAATTAATTTTTAGTAGAGACGG - Intronic
1026989827 7:74578346-74578368 CAGCTAATTTTTTGTAGAGACGG + Intronic
1027024284 7:74839835-74839857 CAGCTAATTTTTAGTAGAGAAGG - Intronic
1027063482 7:75104283-75104305 CAGCTAATTTTTAGTAGAGAAGG + Intronic
1027252221 7:76406146-76406168 CGGCTCATTTTTTGTAGAGATGG + Intronic
1027340054 7:77197509-77197531 CATCTGATTTTTAGGACCAAGGG - Intronic
1027372680 7:77522812-77522834 CAGCTAATTTTTTGTAGATATGG + Intergenic
1027376569 7:77556675-77556697 CAGCTAATTTTTATTAGAGACGG - Intronic
1028411723 7:90537309-90537331 TGGCTAATTTTTAGTAGAGACGG - Intronic
1029067102 7:97861182-97861204 CGGCTAATTTTTAGTAGAGACGG + Intronic
1029155785 7:98516996-98517018 CAACTAATTTTTTGTAGAGATGG + Intergenic
1029318785 7:99738804-99738826 CAGCTAATTTTTAGTACAGATGG + Intergenic
1029323715 7:99787784-99787806 CAGCTAATTTTTAGTACAGATGG + Intergenic
1029336793 7:99907278-99907300 CAGCTAATTTTTAGTAGAGACGG + Intronic
1029501450 7:100933369-100933391 CGGCTAAGTTTTAGTAGAGACGG + Intergenic
1029515872 7:101022652-101022674 CAGCTAATTTATTGTAGAGATGG - Intronic
1029782204 7:102746304-102746326 AAGCTAATTTTTAGCAGAGATGG + Intergenic
1030006927 7:105129122-105129144 CGGCTAATTTTTTGTAGAGACGG + Intronic
1030035350 7:105404024-105404046 CAGCTAATTTTTTGTAGAGATGG + Intergenic
1030233206 7:107229540-107229562 TAGCCGATTTTTAGAAGATAAGG - Intronic
1030272651 7:107686648-107686670 TGGCTAATTTTTAGTAGAGACGG + Intronic
1030289234 7:107855801-107855823 CAGCTGTTTTTTGGTAGAGATGG - Intergenic
1031995929 7:128230961-128230983 CAGCTAATTTTTTGTAGAGATGG - Intergenic
1032129791 7:129218669-129218691 CAGCTGTTTTTTTGGAGACAGGG - Intergenic
1032157628 7:129481995-129482017 CAGCTAATTTTTAGTAGAGATGG - Intronic
1032511320 7:132474932-132474954 CAGCTCATTCATAAGAGAGATGG + Intronic
1032719628 7:134540053-134540075 CAGCTAATTTTTGGTAGAGACGG - Intronic
1032815990 7:135474445-135474467 CAGCTTATTTTTAGTAGAGATGG + Intronic
1032830508 7:135620361-135620383 TTTCTGATTTTTAGTAGAGATGG - Intronic
1033016410 7:137675932-137675954 CAGCTGAGTATTAGGAGCGAAGG - Intronic
1033166194 7:139040589-139040611 TGGCTAATTTTTAGTAGAGATGG - Intergenic
1033304303 7:140213135-140213157 CAGCTAATTTTTTGTAGAGATGG - Intergenic
1033366562 7:140676573-140676595 GAGCTGATTTTTAAGACAAATGG - Intronic
1033531459 7:142268467-142268489 CAGCTGGTTTTAAGAAGTGAAGG - Intergenic
1033714377 7:143984640-143984662 CAGCTAATTTTTAGTGGAGACGG - Intergenic
1033735724 7:144219638-144219660 CAGCTAATTTTTTGTAGAGATGG + Intergenic
1033747327 7:144331315-144331337 CAGCTAATTTTTTGTAGAGATGG - Intergenic
1033965844 7:146974273-146974295 TGGCTAATTTTTAGTAGAGATGG - Intronic
1034078944 7:148258858-148258880 AAAATTATTTTTAGGAGAGATGG - Intronic
1034458203 7:151183237-151183259 CAGCTAATTTTTTGTGGAGATGG - Intronic
1034512196 7:151545092-151545114 CAGCTAATTTTTTGTAGAGATGG - Intergenic
1034607579 7:152331444-152331466 TAGCTAATTTTTTGTAGAGATGG - Intronic
1034626188 7:152494585-152494607 CAGCTAATTTTTAGTAGAGATGG - Intergenic
1034706690 7:153152086-153152108 CAGCTAATTTTTAATAGAGACGG - Intergenic
1035199800 7:157254867-157254889 CAGCTAATTTTTAGTAGAGATGG - Intronic
1037590975 8:20311842-20311864 CAGCTAATTTTTTGTAGAGATGG + Intergenic
1037796084 8:21996250-21996272 CAGCTAATTTTTTGTAGAGGTGG - Intronic
1037944342 8:22977407-22977429 CAGCTAATGTTTTGTAGAGACGG - Intronic
1037976260 8:23215343-23215365 CAGCATATTTTTAGTAGAGACGG - Intronic
1037995653 8:23350564-23350586 CAGCTTATTTTTTGTTGAGATGG - Intronic
1038494016 8:27989296-27989318 CAGCTAATTTTTTGCAGAGATGG + Intronic
1038589330 8:28821935-28821957 CAGTTTATTTTTTGTAGAGATGG + Intronic
1038768892 8:30457746-30457768 CAGCTAATTTTTAGTAGAGACGG + Intronic
1039034415 8:33344273-33344295 CAGCTTGTTCTTAGGAGTGAAGG - Intergenic
1039464227 8:37772177-37772199 CTGCAGTTTTTTAGTAGAGATGG + Intronic
1039528215 8:38235241-38235263 CTACTGATTTTTATTAGAGATGG + Intronic
1039761271 8:40578764-40578786 CATCTTATTTATAGGAAAGAAGG + Intronic
1039806981 8:41008545-41008567 CAGTTAATTTTTGGTAGAGAGGG + Intergenic
1039861634 8:41464106-41464128 CAGCTAATTTTTTGCAGAGATGG + Intergenic
1039924786 8:41919617-41919639 CAGCTAATTTTTAGTAGAGAGGG + Intergenic
1040816999 8:51519368-51519390 TGGCTAATTTTTAGTAGAGATGG - Intronic
1040924903 8:52670100-52670122 CAGCTAATTTTTTGTAGACATGG + Intronic
1040997722 8:53418766-53418788 TGGCTAATTTTTAGTAGAGATGG + Intergenic
1041032156 8:53747993-53748015 CAGCTAATTTTTAGTAGAGACGG - Intronic
1041262286 8:56032199-56032221 CAGCTAATTTTTAGTAGAGATGG - Intergenic
1041619445 8:59949311-59949333 TAGCTAATTTTTTGTAGAGACGG - Intergenic
1042112048 8:65391127-65391149 CAGCTAATTTTTAGTAGAGGTGG - Intergenic
1042175319 8:66032643-66032665 GGGCAGATTTTGAGGAGAGATGG - Intronic
1042893245 8:73636212-73636234 CAGCTAATTTTTTGTAGATATGG - Intronic
1043133601 8:76492537-76492559 CGGCTAATTTTTAGTAGATACGG - Intergenic
1043192827 8:77248318-77248340 AGGCAGATTTATAGGAGAGAAGG + Intergenic
1043500405 8:80848672-80848694 TAGCTGATTTTTTGTAAAGATGG - Intronic
1044244809 8:89930480-89930502 CAGCTGATTTTTTGTAGAGATGG + Intergenic
1044556978 8:93573461-93573483 CAGCATATTTTTAGGGGAAAGGG + Intergenic
1044584811 8:93859433-93859455 CAGCTAATTTTTAGTAGAGTTGG - Intronic
1044747585 8:95385626-95385648 CAGCTAATTTTTTGTAGAGATGG + Intergenic
1044939543 8:97326861-97326883 CAGCTAATTTTTTGTAGAGATGG + Intergenic
1045119006 8:99014972-99014994 CAACTGCTTTTTAGGAGATAAGG + Intronic
1045135308 8:99210766-99210788 CAGCTAATTTTTTGTAGAGATGG + Intronic
1045683480 8:104687548-104687570 CAGCTCATTATTAGAAGAGAAGG - Intronic
1045713752 8:105017360-105017382 CAACTGATTTTTCCTAGAGAAGG - Intronic
1045966668 8:108032885-108032907 CGGCTAATTTTTAGTAGAGATGG - Intronic
1046256010 8:111696793-111696815 CGGCTAATTTTTAGTAGAGATGG + Intergenic
1047078986 8:121438311-121438333 CAACTGATTTTAAGGCCAGAGGG - Intergenic
1047246146 8:123146845-123146867 CAGCTAATCTTTAGTAGAGATGG + Intronic
1047322858 8:123804577-123804599 TATCTGATTTGGAGGAGAGATGG - Intronic
1047516743 8:125561651-125561673 CAGCTAATTTTTTGTAGAAATGG + Intergenic
1047632251 8:126721183-126721205 CAGTTGAATTTGAGAAGAGAAGG + Intergenic
1047788962 8:128182795-128182817 CAGCTGTGTTTCAGCAGAGAGGG + Intergenic
1047833876 8:128666659-128666681 CAGGTTATTTTTAGCAGAAAAGG - Intergenic
1048725110 8:137374547-137374569 CAGCTAATTTTTTGTAGAGATGG + Intergenic
1048855451 8:138683108-138683130 CAGATGAGTGCTAGGAGAGAGGG - Intronic
1049862418 8:144908824-144908846 TGGCTAATTTTTAGTAGAGATGG + Intergenic
1049977199 9:871196-871218 CGGCTAATTTTTTGTAGAGACGG + Intronic
1050257218 9:3807716-3807738 CAGCTGATTTCTAAGTGAAAAGG + Intergenic
1050545848 9:6708075-6708097 TGGCTAATTTTTAGTAGAGACGG - Intergenic
1051032320 9:12696169-12696191 CTGCTTATATTTAGTAGAGAAGG - Intronic
1051417085 9:16853245-16853267 CAGCTAGTTTTTTGTAGAGATGG - Intronic
1051664668 9:19457513-19457535 CTGATGATATTTGGGAGAGAGGG + Intergenic
1052308850 9:27042001-27042023 AGGATGACTTTTAGGAGAGAAGG + Intronic
1052658744 9:31401040-31401062 CAGCTAATTTTTAGTAGAGATGG - Intergenic
1052810975 9:33059780-33059802 TAGTTTATTTTTAGTAGAGAAGG + Intronic
1052913773 9:33907989-33908011 TGGCTAATTTTTAGTAGAGACGG + Intronic
1052950520 9:34206345-34206367 CGGCTAATTTTTTGTAGAGATGG - Intronic
1054765416 9:69038653-69038675 GAGCTAGTTTTTAGTAGAGATGG - Intronic
1054772179 9:69093350-69093372 TGGCTAATTTTTAGTAGAGATGG - Intronic
1054776171 9:69125467-69125489 CAGCTAATTTTTAGTAGAGACGG + Intronic
1054907857 9:70426385-70426407 CAGCTAATTTTTAGTAGAGATGG + Intergenic
1055280642 9:74670458-74670480 CAGCTGATTTCTAGTTCAGAAGG - Intronic
1055323857 9:75108060-75108082 CAGCTCATTTTTTGTAGAGACGG - Intronic
1055475993 9:76664681-76664703 GAGCTAATTTTTAGGAGAGATGG + Intronic
1055530647 9:77179397-77179419 CGGCTAATTTTTAGTAGAGAGGG + Intronic
1056215474 9:84402406-84402428 TATTTTATTTTTAGGAGAGATGG + Intergenic
1056645570 9:88408834-88408856 TGGCTAATTTTTAGTAGAGACGG + Intronic
1056648022 9:88431876-88431898 CAGCTAATTTTTTGTAGAGAAGG - Intronic
1057123546 9:92598935-92598957 TGGCTAATTTTTAGTAGAGATGG - Intronic
1057357281 9:94342120-94342142 TGGGTGATTTTTAGTAGAGACGG + Intergenic
1057390335 9:94637559-94637581 CAGCTAATTTTTGGTAGAGACGG + Intronic
1057527977 9:95819254-95819276 CTGCTAATTTTTAGTAAAGATGG - Intergenic
1057650471 9:96915506-96915528 TGGGTGATTTTTAGTAGAGACGG - Intronic
1057792145 9:98131486-98131508 CCGCTGATTTTTTGCAGAGATGG + Intronic
1057808522 9:98239219-98239241 CAGCTAATTTTTTGTAGAGATGG + Intronic
1058033498 9:100225218-100225240 CGGCTAATTTTTCGTAGAGATGG + Intronic
1058273196 9:103002522-103002544 CACCTGGTTTTTAGTAGAGACGG + Intronic
1058398249 9:104581239-104581261 CAGCTAATTTTTTGTAGAGACGG + Intergenic
1058403533 9:104644470-104644492 CAGCTAATTTTTAGTAGAGACGG - Intergenic
1058620442 9:106877550-106877572 TGGCTAATTTTTAGTAGAGATGG + Intronic
1058817182 9:108695043-108695065 CAGCTAATTTTTAGTAGAGATGG - Intergenic
1058855593 9:109058774-109058796 CAGCTAATTTTTTGTAGAGATGG + Intronic
1058886298 9:109323663-109323685 CGGCTAATTTTTTGTAGAGATGG + Intergenic
1058925545 9:109660001-109660023 CAGCTAATTTTTTGTAGAGATGG + Intronic
1059293298 9:113246808-113246830 CAGCTAATTTTTAGTAGAGATGG + Intronic
1059511769 9:114855052-114855074 CAGCTAATTTTTTGTAGAGATGG + Intergenic
1059566571 9:115388406-115388428 CAGCTAAGTTTTTGTAGAGATGG + Intronic
1059940238 9:119351966-119351988 CAGCTAATTTTTAGTAGAGGTGG + Intronic
1060383428 9:123199105-123199127 CGGCTAATTTTTAGTAGAGATGG + Intronic
1060907224 9:127317552-127317574 TGGCTAATTTTTAGTAGAGATGG - Intronic
1060913064 9:127366211-127366233 AAGCTAATTATTAGAAGAGAAGG + Intronic
1060958185 9:127659459-127659481 CAGCTAATTTTTGGTAGAGATGG + Intronic
1061021984 9:128021878-128021900 CGGCTAATTTTTTGTAGAGATGG + Intergenic
1061072474 9:128319800-128319822 CAGCTAATTTTTACTAGAGACGG + Intronic
1061153110 9:128840419-128840441 CAGCTAATTTTTATTAGAGATGG + Intronic
1061243557 9:129388921-129388943 CAGCTAATTTTTGGGAGAGATGG + Intergenic
1061315236 9:129791453-129791475 CAGCTAATTTTTAGTAGAGACGG - Intergenic
1061691835 9:132339310-132339332 CAGCTAATTTTTTGTAGAGATGG - Intronic
1061696009 9:132374075-132374097 CGGCTAATTTTTGGTAGAGATGG + Intergenic
1185662947 X:1741522-1741544 CAGCTAATTTTTTGTAGAGATGG - Intergenic
1185678535 X:1868691-1868713 CAGCTAATTTTTAGTAGAGAGGG - Intergenic
1185696648 X:2199932-2199954 AAGTTTATTTTTAGCAGAGACGG - Intergenic
1185911508 X:3985195-3985217 CAGCTAATTTTTTGTAGAGATGG + Intergenic
1186405110 X:9294996-9295018 CAGCTAATTTTTTGTAGAGATGG - Intergenic
1187082152 X:16002217-16002239 CAGCTTATATTTTTGAGAGAAGG + Intergenic
1187244406 X:17540907-17540929 CAGCTAATTTTTTGTAGAGACGG - Intronic
1187540851 X:20192761-20192783 CAGCTAATTTTTTGTAGAGATGG + Intronic
1187819151 X:23267267-23267289 CAAGTTATTTTGAGGAGAGAGGG + Intergenic
1188257893 X:27984422-27984444 AGGCTAATTTTTAGTAGAGATGG - Intergenic
1188347087 X:29080214-29080236 CAACTAATTTTTTGTAGAGATGG - Intronic
1188386482 X:29566109-29566131 CGGCTAATTTTTTGTAGAGACGG + Intronic
1188908388 X:35815675-35815697 CAGCTAATTTTTTGTAGAGATGG + Intergenic
1188914177 X:35889816-35889838 CAGCTAATTTTTTGTAGAGATGG + Intergenic
1188948103 X:36333501-36333523 CTAGAGATTTTTAGGAGAGAGGG - Intronic
1189807809 X:44752847-44752869 CAGCTAACTTTTTGTAGAGACGG - Intergenic
1190051278 X:47151199-47151221 CAGCTAATTTTTTGTAGAGACGG + Intronic
1190088519 X:47417360-47417382 CAGCTAATTTTTACTAGAGACGG - Intergenic
1190091409 X:47440671-47440693 CAGCTAATTTTTAGTAGAGACGG + Intergenic
1190111359 X:47591053-47591075 CAGCTAATTTTTTGTAGAGACGG + Intronic
1190121243 X:47661024-47661046 CAGCTAATTTTTTGTAGAAATGG + Intergenic
1190144014 X:47874212-47874234 CAGCTCACTTTTAGCAGAAAGGG + Intronic
1190191158 X:48278339-48278361 CAGCTAATTTTTTGTAGACACGG - Intergenic
1190239952 X:48650107-48650129 CAGCTCATTTTTAGTAGAGATGG + Intergenic
1190258015 X:48779031-48779053 CAACTGATTTTTTTGAGACAGGG + Intergenic
1190306985 X:49089622-49089644 CAGCTACTTTTTTGTAGAGATGG - Intronic
1190379571 X:49827236-49827258 CATCTTATCTGTAGGAGAGAGGG + Intergenic
1190754985 X:53393984-53394006 CAGCTAATTTTTAGTAGAGGCGG - Intronic
1190822081 X:53983021-53983043 CAGCTTATTTTTTGTACAGATGG - Intronic
1191858752 X:65648698-65648720 TGGCTAATTTTTAGTAGAGACGG - Intronic
1192124272 X:68487123-68487145 CAGTTGATTGTGAGGAGAAATGG + Intergenic
1192281813 X:69695670-69695692 CAGCTAATTTTTAGTAGAGATGG + Intronic
1192470780 X:71396860-71396882 CAGCTAAATTTTTGTAGAGACGG - Intronic
1192506838 X:71691378-71691400 TGGCTAATTTTTTGGAGAGACGG - Intergenic
1192519859 X:71790168-71790190 TGGCTAATTTTTTGGAGAGACGG + Intergenic
1192536821 X:71935493-71935515 CAGCTCATTTGAAGGAGAGGGGG + Intergenic
1192746400 X:73943204-73943226 CAGCTAATTTTTACTAGAGACGG - Intergenic
1192806686 X:74516221-74516243 CAGCTGATTTTTTGTAGAGATGG + Intronic
1193151145 X:78125677-78125699 CAGCTCTTTTTTAGGATATATGG - Intronic
1193282498 X:79670197-79670219 TGGCTAATTTTTAGTAGAGACGG + Intergenic
1193454084 X:81707878-81707900 CGGCTAATTTTTAGTAGAGACGG + Intergenic
1193834610 X:86326302-86326324 CAGCTAATTTTTTGTAGAGATGG - Intronic
1194806893 X:98340458-98340480 CAACTGATTTTTGACAGAGATGG - Intergenic
1194863118 X:99029192-99029214 CTGCTAATTTTTTGTAGAGATGG + Intergenic
1195196404 X:102501541-102501563 CAGCTAATTTTTTGTGGAGACGG + Intergenic
1195241848 X:102960172-102960194 CAGCTGCTTTTTAGATAAGAAGG - Intergenic
1195619000 X:106934654-106934676 AAACTCATTTTTAGTAGAGATGG + Intronic
1195646312 X:107234556-107234578 CATTTGATTCTTAGGAAAGAAGG - Intronic
1195667638 X:107445227-107445249 CAGCTGCATTTGAGGGGAGAGGG + Intergenic
1195770957 X:108350743-108350765 CAGATGCTTTTTGGGAGAGTGGG - Intronic
1195795025 X:108637103-108637125 TAGCTAATTTTTTGTAGAGATGG + Intronic
1195919540 X:109969330-109969352 CAACTGATTTTTTTGAGAGATGG - Intergenic
1196552961 X:117051981-117052003 CAACTAATTTTTGGTAGAGATGG + Intergenic
1196669428 X:118349718-118349740 CAGCTAATTTTTAGGAGAGACGG + Intronic
1196845418 X:119893265-119893287 CAGCTACTTTTTAGTAGAGACGG + Intergenic
1196908260 X:120460108-120460130 CAGCAAATTTTTAGTGGAGATGG - Intronic
1197230326 X:123997218-123997240 AAGCTGATTCTTAGGTGAAAAGG - Intronic
1197235522 X:124058318-124058340 CAGCTAATTTTTAGTACAGACGG + Intronic
1197756658 X:130000206-130000228 CGGCTAATTTTTTGTAGAGATGG + Intronic
1198141623 X:133809806-133809828 CAGATGAGTTTTAGGACACAGGG - Intronic
1198652201 X:138875067-138875089 CAGCTAATTTTTAGTAGAGACGG - Intronic
1200331987 X:155307712-155307734 CAGCTAATTTTTAGTAGAGATGG - Intronic
1201364127 Y:13185253-13185275 TGGCTAATTTTTAGTAGAGATGG + Intergenic