ID: 992045971

View in Genome Browser
Species Human (GRCh38)
Location 5:72889788-72889810
Sequence CTCCTCTTCTAGGGTAGCAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 2, 1: 0, 2: 1, 3: 8, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992045971_992045977 26 Left 992045971 5:72889788-72889810 CCTTTGCTACCCTAGAAGAGGAG 0: 2
1: 0
2: 1
3: 8
4: 114
Right 992045977 5:72889837-72889859 TGCTTATATACTTGATACCCTGG 0: 4
1: 0
2: 2
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992045971 Original CRISPR CTCCTCTTCTAGGGTAGCAA AGG (reversed) Exonic
901173310 1:7279915-7279937 CTCCTCTCCTGGGGTTGGAAGGG + Intronic
906705015 1:47888396-47888418 CTCCTCTCCCAGGGTCCCAAGGG - Intronic
909873923 1:80779322-80779344 CTCCAGTTCAAGGATAGCAAGGG - Intergenic
911128070 1:94360090-94360112 CTCCTCTTCTGGGAAAGCAGTGG + Intergenic
924615812 1:245610982-245611004 CTCCTCTTTTTGGGGAGAAAAGG - Intronic
1068903040 10:62291415-62291437 CTGCTCTTCTAGTCTAACAAGGG + Intergenic
1072017079 10:91359038-91359060 GTTCTCTTTTAGGGTATCAAAGG + Intergenic
1072685575 10:97534679-97534701 CCCCACTTCTGGGGTAGAAAAGG + Intronic
1073098968 10:100997302-100997324 TTCCGCTTCTAGGGAAGCTAGGG + Intronic
1073737577 10:106367445-106367467 CTCCTCTTCTTGAGTATGAATGG - Intergenic
1076438798 10:130465105-130465127 CACCTCGTCCAGGGCAGCAAGGG + Intergenic
1079174755 11:18128678-18128700 CTCCTTTTCTTGGCTAGGAAAGG + Intronic
1087137375 11:94734645-94734667 CTCCTCTCCCAGGGGAGCATGGG - Intronic
1089248132 11:117137408-117137430 CTCATCCCCTAGGGCAGCAAGGG - Intergenic
1089258007 11:117204203-117204225 CTCCTCTTCTAGGAAAGCGCAGG + Exonic
1089258581 11:117207153-117207175 CTCATCCCCTAGGGCAGCAAGGG + Exonic
1089637524 11:119825107-119825129 CTCCTCTTCTATGGTTGCTCAGG + Intergenic
1089905683 11:122035829-122035851 CCCCTCCTCCAGGGTAGCATGGG - Intergenic
1089931330 11:122316179-122316201 CTCATCTTCTTGGCTAGCATGGG + Intergenic
1090050479 11:123373753-123373775 CTCCTATTCTAGGGAGGCAGAGG - Intergenic
1090400488 11:126445464-126445486 CTCCTCTCCCAGGCTAGCCATGG + Intronic
1091833771 12:3569661-3569683 CTCCTCTTCAGGGACAGCAATGG - Intronic
1092343349 12:7694977-7694999 CTACTCTTGTTGGGTGGCAAAGG - Intronic
1104588281 12:130064511-130064533 CTCCCAATCTTGGGTAGCAAGGG - Intergenic
1104960375 12:132485867-132485889 TTCCTTTTCTAGGGGAGCATGGG + Intergenic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1110127263 13:71961118-71961140 CTCCTCTTTTAAAATAGCAATGG - Intergenic
1111510104 13:89250172-89250194 CTCCTCTTGGAGGTTTGCAAGGG + Intergenic
1111857720 13:93660933-93660955 CTTCTCTCCTATGGGAGCAAGGG + Intronic
1115141909 14:30181778-30181800 TTCCTCTTCCAGGGTGGAAAAGG - Intronic
1117375783 14:55117217-55117239 CTCTGCTTCTGGGTTAGCAAAGG - Intergenic
1118004475 14:61553232-61553254 CTCCTCTACGAGGGGAGAAAGGG - Intronic
1118096716 14:62545627-62545649 CTCCTTTTCTATGGTATCAATGG + Intergenic
1122146048 14:99689441-99689463 CTCCACTTCTGGGGTAGCTCTGG - Intronic
1123434028 15:20241882-20241904 CCCATCTACTAGGGTAGCTAAGG + Intergenic
1124698999 15:31894749-31894771 CTCCTCTCCTAGGGTTGGGAAGG + Intergenic
1127302060 15:57664384-57664406 CTCCTCTCCTAGGGAATCAGAGG + Intronic
1132788073 16:1669191-1669213 CTCCTTTTCCAGGGCAGCAGGGG + Intronic
1134623950 16:15710759-15710781 CTCCTCCTCCTGGGTTGCAAAGG + Intronic
1139338722 16:66252559-66252581 CTCCTATTTTGAGGTAGCAAAGG + Intergenic
1139550167 16:67668431-67668453 CTCCTCTCCGAGGGGAGCCAGGG - Exonic
1139735688 16:68986039-68986061 TTGCTCTTCCAGGGAAGCAAAGG - Intronic
1140045902 16:71440651-71440673 TGGCTCTTCTAGGGGAGCAAAGG - Intergenic
1143270757 17:5672884-5672906 CTCCTCTACCAGGGGAGAAATGG + Intergenic
1143629796 17:8132098-8132120 CTCCTCATCTAGGGTAGGAATGG + Intergenic
1144885956 17:18461898-18461920 CTCCTCTTCTAGGGTAGCAAAGG - Intergenic
1146987451 17:37233872-37233894 TAGCTATTCTAGGGTAGCAAAGG + Intronic
1148844740 17:50522967-50522989 CTCGCCTTCTAGGGTTTCAAAGG - Exonic
1151294465 17:73174346-73174368 CTCCTCATCTAGGGCAGCTGGGG - Intergenic
1160880052 19:1315637-1315659 CTCCTTTTCTAGGGTGGCGGTGG + Intergenic
1165030247 19:32993000-32993022 CCCATCTACTAGGGTAGCTAAGG + Intronic
1166227140 19:41403261-41403283 CTCCGTATCTAGGGTAGCTAAGG - Intronic
1167398172 19:49245372-49245394 CTGCTCCTCTAGGGCTGCAATGG + Intergenic
926131624 2:10306412-10306434 CTGCTCTCCTATGGTAGCAGGGG + Intronic
928401980 2:30985625-30985647 CTCCTCCTCTGGGGGAGGAAGGG - Intronic
931179984 2:59889960-59889982 CTCCTCCTCCAGAGTAACAAGGG - Intergenic
931250536 2:60527357-60527379 CTTCTCTTCCAGGGTGACAAGGG + Intronic
931687495 2:64806964-64806986 TTCATCTTCAAGGCTAGCAATGG - Intergenic
931735449 2:65189399-65189421 CTCCTCTTCTGGGACAGGAAGGG - Intergenic
932649343 2:73538625-73538647 CTCCTTTCCTTGGCTAGCAAAGG - Intronic
935130602 2:100258292-100258314 CTCCTCTCCTGGGGTGACAAAGG - Intergenic
936005357 2:108882444-108882466 ATCCTTTTCTATGCTAGCAAAGG + Intronic
942623366 2:177872354-177872376 CTCCTCTTCCAGGGTATCACTGG - Intronic
943559364 2:189442380-189442402 CTACTCTTCTAAGGCAGAAAGGG - Intronic
943779562 2:191807341-191807363 CTCTTCTTATAGGGGAGCATAGG + Intergenic
945157561 2:206855699-206855721 CTCGCCTTCAGGGGTAGCAATGG - Intergenic
1169759220 20:9073308-9073330 CTCCTGTTCTAGAGAAGAAAGGG - Intronic
1170206167 20:13800896-13800918 CTCCTCCTCTAGGCTAGCTCAGG + Intronic
1171226968 20:23449841-23449863 TTCCTCTCCTAGAGGAGCAAAGG - Intergenic
1174579196 20:51559078-51559100 CTTCCCTTCCTGGGTAGCAAGGG + Intronic
1176662182 21:9647434-9647456 TTCCTCCTCTAGGGAAGAAAAGG + Intergenic
1179290043 21:40010420-40010442 CTTCTCTTCAAGGGTAGACATGG + Intergenic
1180117539 21:45720693-45720715 TTACTCTTGTAGGGTTGCAATGG + Intronic
949836453 3:8275261-8275283 CTCCACTTCTGGGGTAGTGAAGG + Intergenic
950608996 3:14112899-14112921 CTCCTCTTCTTTGGTTGCAGTGG + Exonic
951503372 3:23415428-23415450 ATCCTATACTATGGTAGCAAAGG - Intronic
952007111 3:28854707-28854729 CTCCTCTGCAAAAGTAGCAACGG - Intergenic
952807207 3:37367408-37367430 ATCTTTTTCTAGGGTAGAAATGG + Intergenic
960230909 3:115226305-115226327 CACCTCTTGTAGGGTGGGAAAGG - Intergenic
965904722 3:173689562-173689584 CTCCTTCTTTAGGGTAACAAAGG - Intronic
971158622 4:24109845-24109867 CACCACTTCTAAGGAAGCAAAGG - Intergenic
977767865 4:100822219-100822241 CTCCTTTTCTAAGGGAGCATAGG - Intronic
978392369 4:108240707-108240729 GTGCTCTTCTAGGATAGGAAGGG + Intergenic
978918473 4:114152617-114152639 TACCTATTCTGGGGTAGCAAGGG + Intergenic
980295865 4:130915602-130915624 CTTCTCTGCTACAGTAGCAACGG + Intergenic
980499824 4:133634792-133634814 TTCCTCTTCTTGAGTAGCAGGGG - Intergenic
985413212 4:189709082-189709104 TTCCTCCTCTAGGGAAGAAAAGG - Intergenic
992045971 5:72889788-72889810 CTCCTCTTCTAGGGTAGCAAAGG - Exonic
995865068 5:116681722-116681744 CACCTCTTCTACGGAAACAATGG + Intergenic
995881514 5:116849232-116849254 ATCCTCTTCTTGGCTAGCCAAGG + Intergenic
997611384 5:135218135-135218157 CTCCTCTTCTAGGGTAAACAAGG + Intronic
1000295155 5:159906997-159907019 CTGCCCTTCTAGGGTATGAATGG + Intergenic
1007478610 6:42135487-42135509 CTCCTCCGCTCGGGGAGCAAGGG - Intronic
1007849204 6:44788042-44788064 CTCCTCTACTTGGGTAGTAGAGG - Intergenic
1008016964 6:46531634-46531656 CTACTCTTCTAGTGCAGCAAAGG - Intergenic
1009055697 6:58332227-58332249 CTCACCTTCTGGGGTAGAAATGG - Intergenic
1009235473 6:61118368-61118390 CTCACCTTCTGGGGTAGAAATGG + Intergenic
1015597317 6:134878113-134878135 GTCCTCTTTTTGGGAAGCAATGG - Intergenic
1016285210 6:142464761-142464783 CTGCTCTTCTAGGGTATCTTTGG - Intergenic
1016393625 6:143599681-143599703 CTGTTCTTATAGGCTAGCAAGGG - Intronic
1019075598 6:169385129-169385151 ATCGTGTTCTAGTGTAGCAAAGG - Intergenic
1020356137 7:7277825-7277847 CTCCTCTTCTGGGGTAGGGTGGG - Intergenic
1032242440 7:130174467-130174489 CTGCTTTTCTAGGGTTGCTATGG - Intronic
1032378538 7:131449917-131449939 CTCTACTCCTAGGGTAGCCATGG - Intronic
1037936838 8:22920619-22920641 CTGTTCTTCTAGGGAAGTAAAGG - Intronic
1043319388 8:78963615-78963637 TTGCTCTTCTATAGTAGCAATGG - Intergenic
1044204106 8:89471672-89471694 GTCATCTTCTAGGGTAGCCATGG - Intergenic
1044685566 8:94823050-94823072 AACCTCATCTAGGGTTGCAACGG - Intronic
1045000187 8:97871541-97871563 CCCGTCTTCTAGGGAAGCTATGG + Intronic
1047852806 8:128877293-128877315 CTCCTGGTCTAGCGCAGCAACGG + Intergenic
1049916914 9:326755-326777 CTCTTCTTCAGGGGCAGCAATGG - Intronic
1050691737 9:8234759-8234781 CTCCAGTTCTCAGGTAGCAACGG - Intergenic
1051164116 9:14243461-14243483 CTCCTCTTCTAGATTCTCAAGGG - Intronic
1052401406 9:28005007-28005029 CCCCTCTTCTTGCGTAACAAAGG - Intronic
1052622995 9:30938330-30938352 CTCTTGTTCCAGGGTAGGAAAGG - Intergenic
1055942467 9:81663584-81663606 TACCTCTGCTAGGGTAGCAAGGG - Intronic
1057878107 9:98772920-98772942 CACCTCTTCTAGGGCAGAATGGG + Intronic
1061196187 9:129108398-129108420 CTCCTCTTCCAGGGTGAGAAAGG - Intronic
1187719559 X:22137107-22137129 CTCCTCTTCTACTCTGGCAAGGG - Intronic
1188707475 X:33353591-33353613 CTTCTCTTCTTTGTTAGCAATGG + Intergenic
1193811141 X:86053320-86053342 CTCCTTTTCTTAGGTAGCCAGGG + Intergenic
1194938886 X:99985459-99985481 TTCTTCTTCTAGGGTTGGAATGG + Intergenic
1195106121 X:101603040-101603062 CTCCTCTTTGAGAGTAGCAATGG - Intergenic
1198250801 X:134877604-134877626 CTCCTCTTCTGGTGTAGTTAGGG + Intergenic
1200966583 Y:9044659-9044681 CTCTCCTCCTAGGGTGGCAAAGG - Intergenic