ID: 992046326

View in Genome Browser
Species Human (GRCh38)
Location 5:72893970-72893992
Sequence GGTACCAAGGCTTCCCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992046326_992046332 21 Left 992046326 5:72893970-72893992 CCCACCAGGGAAGCCTTGGTACC 0: 1
1: 0
2: 3
3: 9
4: 97
Right 992046332 5:72894014-72894036 TTTTTGAGTAGCCACCTTTTTGG No data
992046326_992046333 27 Left 992046326 5:72893970-72893992 CCCACCAGGGAAGCCTTGGTACC 0: 1
1: 0
2: 3
3: 9
4: 97
Right 992046333 5:72894020-72894042 AGTAGCCACCTTTTTGGTAGAGG 0: 1
1: 0
2: 1
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992046326 Original CRISPR GGTACCAAGGCTTCCCTGGT GGG (reversed) Intronic
900105358 1:978748-978770 GGTCCCCAGGCTCCCCTGCTAGG + Intronic
901448721 1:9323465-9323487 GGTACCAAGGCTGACCTTGAAGG + Intronic
901469956 1:9449386-9449408 GCTAACAAGGCTTCCCACGTGGG - Intergenic
906339241 1:44963568-44963590 GCCAACAAGACTTCCCTGGTTGG - Intronic
907314620 1:53560503-53560525 GGTACGAAGGGTTAACTGGTGGG - Intronic
910181642 1:84490830-84490852 GGTACAAAGTCTGCCCTGGGAGG + Intronic
910549651 1:88461593-88461615 GGTTCCAAGGAAGCCCTGGTTGG + Intergenic
910693120 1:89984789-89984811 GGTCCCAAGCCCTGCCTGGTGGG + Intergenic
915920654 1:159973214-159973236 GGTAACCAGGCTTCCCTCTTAGG + Intergenic
922226945 1:223653673-223653695 GATACCAAGGCTTCACAGATGGG - Intronic
1065756627 10:28936557-28936579 GGTACCCAGACATCCCTGTTTGG + Intergenic
1067770615 10:49120968-49120990 GGTAGGGAGGCTTCCCAGGTGGG - Intergenic
1069207857 10:65715158-65715180 GGTACCTACGCTTCCCTAGTGGG + Intergenic
1069882883 10:71604623-71604645 GGGACCATGGCTTCCCAGGTGGG - Intronic
1073012719 10:100373746-100373768 GGTCCCATCGCTTCCCTGCTGGG + Intergenic
1074929775 10:118112518-118112540 TTTACCAAGTCTTCCCTGGCTGG - Intergenic
1077341629 11:2028831-2028853 GGAACCAGTGCTGCCCTGGTGGG + Intergenic
1077414840 11:2420183-2420205 GGTCCCAAGGCTTCCCTGGGTGG + Intronic
1080434712 11:32229097-32229119 GGCTCCCAGGTTTCCCTGGTGGG - Intergenic
1080822926 11:35824367-35824389 CTTAACAAGGCTTCCCTTGTGGG - Intergenic
1084718979 11:70892081-70892103 GCTACAAAGGCTTCCCTCGGGGG + Intronic
1084857218 11:71996929-71996951 GGCCCCAAGGCTTCCCTTGTTGG - Exonic
1091062522 11:132477098-132477120 GGTTCCCAGGTTTCCCAGGTTGG + Intronic
1202824615 11_KI270721v1_random:84020-84042 GGAACCAGTGCTGCCCTGGTGGG + Intergenic
1091795114 12:3293674-3293696 AGTGCGAAGGCTTTCCTGGTCGG + Intergenic
1095418313 12:41999211-41999233 GGAACCAAGGCTCCCTTGATGGG + Intergenic
1096252256 12:50040765-50040787 GTTGGCAAGGCTTCCCTGGATGG + Intergenic
1101444600 12:104728708-104728730 GGGAGCAAGCCTTCCCGGGTAGG - Intronic
1101650540 12:106673395-106673417 GGTACCCAGGCTTGCCTCCTGGG - Intronic
1101777183 12:107805974-107805996 GTGACCAAGGCAGCCCTGGTGGG - Intergenic
1102741201 12:115208979-115209001 GGTACAAAGCCTTACCTGTTTGG - Intergenic
1103600817 12:122053497-122053519 GCGACCAAGACTTCCCTGCTGGG - Intronic
1104487505 12:129164000-129164022 GTTCCCAGGCCTTCCCTGGTGGG + Intronic
1106544302 13:30716984-30717006 GACACCAAGGCTTCCCTGGTGGG - Intronic
1106645519 13:31629791-31629813 GGTACCAACACTGCCATGGTGGG - Intergenic
1112988144 13:105477530-105477552 GGCATCTAGGTTTCCCTGGTTGG - Intronic
1113610634 13:111642454-111642476 TGTTCCAAGGCTGCCCTGGAAGG - Intronic
1115714035 14:36083206-36083228 GGCAGCAAGTCTTCCCTGGGTGG - Intergenic
1128288060 15:66454967-66454989 GGAACCAAGGCTACTCTAGTTGG + Intronic
1128496443 15:68201071-68201093 GGCACTCAGGCCTCCCTGGTAGG + Intronic
1132597593 16:760491-760513 GGTTTCATGGCTTCCCTGGGTGG - Intronic
1134401517 16:13914434-13914456 GGTTCCCAGGCTTACCTGGTTGG + Intergenic
1136064788 16:27751337-27751359 GGAACCAAGGCTTGCCGGGTTGG + Intronic
1137481288 16:48853773-48853795 GTTACAAAGGTTACCCTGGTGGG + Intergenic
1142249170 16:88983295-88983317 GGTCCCAAGGCTGCGCTGGGCGG - Intergenic
1144058766 17:11562902-11562924 GGTACGAGGGCATCCCTGGGTGG - Exonic
1149724259 17:58877217-58877239 GGTACCAAGGCTACCTATGTTGG - Intronic
1149868016 17:60161412-60161434 GGCACCCAGGTTTCCCTGGCTGG + Intronic
1150218839 17:63484626-63484648 GGTACCAGGGCTCAGCTGGTAGG - Intergenic
1150621775 17:66812912-66812934 GGGACCAAGGATTCAATGGTTGG + Intergenic
1152562318 17:81084729-81084751 GGTCACAGGGCTTCCCTGGGTGG + Intronic
1152754614 17:82082004-82082026 GGCACGAAGGCCTCCCAGGTGGG - Exonic
1153765259 18:8368578-8368600 GGTAATGAGGCTTCCCTGGAAGG + Intronic
1156482246 18:37443604-37443626 GGCTCCAAGGCTCCCCTGGAAGG + Intronic
1159019162 18:63128843-63128865 GGTGCCCAGGCTGCCCTGGCAGG - Intronic
1163436415 19:17298348-17298370 GGGACCAAGCCTTCCATGGAGGG + Intronic
1166872237 19:45877688-45877710 GGTCCCAAGCCCTCCCTGGCAGG + Intergenic
925270645 2:2604825-2604847 GGTCCCAAGGCTTGGCTGGAAGG - Intergenic
926190848 2:10726505-10726527 GGGACCTTGGATTCCCTGGTTGG + Exonic
929824660 2:45300812-45300834 GGCAACAAGGCTTCCCATGTAGG + Intergenic
930009406 2:46924283-46924305 GATACCAAGGCTTCCCTGGGGGG - Intronic
930095536 2:47563280-47563302 GGCACCAAGGCTTCCCAGAAGGG - Intronic
932704140 2:74010238-74010260 GCTTCCCAGGCTTCCCGGGTTGG - Intronic
935677753 2:105610179-105610201 GCTGCCAAGGCTTCCCAGCTGGG + Intergenic
937918826 2:127115623-127115645 GGTACCAGGCAGTCCCTGGTAGG + Intergenic
938305080 2:130247795-130247817 GGTTCCAAGGCCTCCATGCTGGG + Intergenic
938448934 2:131399412-131399434 GGTTCCAAGGCCTCCATGCTGGG - Intergenic
942786105 2:179704885-179704907 GGCACCAAGGATTGTCTGGTGGG - Intronic
946109909 2:217405712-217405734 GATACCAAGGCTCTCCTGGGTGG + Intronic
947239301 2:227977034-227977056 GACACTAAGGCTTCCCTGGTTGG + Intergenic
948112838 2:235470857-235470879 GGTCCAAGAGCTTCCCTGGTGGG - Intergenic
1169558181 20:6770331-6770353 GGCACCACGGCGTCCCTGCTGGG - Exonic
1170315425 20:15035794-15035816 GGTCCCTAGGATTTCCTGGTAGG - Intronic
1172689373 20:36779717-36779739 GACAGGAAGGCTTCCCTGGTAGG + Exonic
1173144065 20:40509968-40509990 GGTACTAGAGATTCCCTGGTGGG + Intergenic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
955348950 3:58180146-58180168 GCTACCAAGGCTGACCTGGATGG - Intergenic
955548657 3:60059079-60059101 GGTAGCGTGGCTTTCCTGGTGGG - Intronic
966315952 3:178645565-178645587 GCTCCCAGGGCTGCCCTGGTGGG - Intronic
966912131 3:184565525-184565547 GCTACCAAGGCTTGGCTGGAGGG - Intronic
967125660 3:186421897-186421919 GTTACCAATGTGTCCCTGGTGGG + Intergenic
968913510 4:3487262-3487284 GGGCCCACGGCTTCTCTGGTGGG - Intronic
974162928 4:58163334-58163356 GATTCCAAGACTTCCCTAGTGGG - Intergenic
989167530 5:38446068-38446090 GGAACCAAGGAGTCCCTGGTGGG - Intronic
992046326 5:72893970-72893992 GGTACCAAGGCTTCCCTGGTGGG - Intronic
1001280454 5:170382815-170382837 GGTGCCAATTCTTCCCTGCTAGG + Intronic
1001433865 5:171684615-171684637 GGCACCTATGCTTCCCTGGGTGG + Intergenic
1013802219 6:113960490-113960512 GTTACCAAAACTTCCCTGATGGG - Intronic
1020279715 7:6644074-6644096 GGTCCTAGGGCTTCCCTGGGAGG - Intronic
1022258091 7:28679373-28679395 GTTTCCAAGGCTGCCCTGGTGGG - Intronic
1023968945 7:44977785-44977807 GGTACCCACCCTTCCCTGGATGG + Intronic
1024510622 7:50201724-50201746 GGTAGCAAAGCTTCTCTGGCAGG + Intergenic
1026051760 7:66952779-66952801 GGTGCCGAGGCCTTCCTGGTGGG + Intronic
1032240419 7:130154887-130154909 GGTACCAAGGACACCCTGATGGG - Intergenic
1033444902 7:141411970-141411992 GGTCCCAGGGCTTCCCAGGTTGG + Intronic
1034525079 7:151654176-151654198 GGAAGAAAGGCTTTCCTGGTTGG - Intronic
1036208141 8:6820127-6820149 GGTATCAAGCCTTAGCTGGTCGG + Intronic
1038327581 8:26583944-26583966 GGAACCAAGGCGGCCCTGGCTGG + Exonic
1038337838 8:26659837-26659859 GGTACCAAAGCTGGCCTGGAAGG + Intergenic
1039153689 8:34531496-34531518 GGTACCAAGGGTTCCCTAACTGG + Intergenic
1049297432 8:141850186-141850208 GGGACCAGGCCTTCCCTGGGGGG + Intergenic
1056160623 9:83888358-83888380 GGTACAAATGCTTTCCTAGTTGG - Intronic
1058420410 9:104828128-104828150 GGCAACAAGGCTTCCCTGAATGG - Intronic
1058715607 9:107719644-107719666 GGTGCCAAGGGCTCCCTGGCTGG + Intergenic
1062195840 9:135273487-135273509 GATACCAAGGTTTCCGGGGTGGG - Intergenic
1185582252 X:1218574-1218596 GTTGCCAAGGGTTCCCTGGGGGG + Intergenic
1188650921 X:32631417-32631439 GGTAGCAATTTTTCCCTGGTGGG + Intronic
1189184534 X:39041922-39041944 GGTACCCATGCTTCCCAGATGGG + Intergenic
1192918529 X:75680936-75680958 GGTTCCAAGTCTTTCCTGTTGGG + Intergenic
1196101748 X:111854041-111854063 GGTATGATGGCTTCCCTGGATGG - Exonic