ID: 992049968

View in Genome Browser
Species Human (GRCh38)
Location 5:72932871-72932893
Sequence GGGTGTTCAAAGTTTAACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992049968_992049971 -6 Left 992049968 5:72932871-72932893 CCCAAGTTAAACTTTGAACACCC No data
Right 992049971 5:72932888-72932910 ACACCCCCTGAGGAACCTGCAGG No data
992049968_992049976 8 Left 992049968 5:72932871-72932893 CCCAAGTTAAACTTTGAACACCC No data
Right 992049976 5:72932902-72932924 ACCTGCAGGACTATCAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992049968 Original CRISPR GGGTGTTCAAAGTTTAACTT GGG (reversed) Intergenic
No off target data available for this crispr