ID: 992050400

View in Genome Browser
Species Human (GRCh38)
Location 5:72935540-72935562
Sequence TGCAGCCAGAGCCTCCCCGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992050389_992050400 17 Left 992050389 5:72935500-72935522 CCCACCATGCCTGAGCTCCCTCA No data
Right 992050400 5:72935540-72935562 TGCAGCCAGAGCCTCCCCGACGG No data
992050392_992050400 8 Left 992050392 5:72935509-72935531 CCTGAGCTCCCTCAACACCAGTG No data
Right 992050400 5:72935540-72935562 TGCAGCCAGAGCCTCCCCGACGG No data
992050390_992050400 16 Left 992050390 5:72935501-72935523 CCACCATGCCTGAGCTCCCTCAA No data
Right 992050400 5:72935540-72935562 TGCAGCCAGAGCCTCCCCGACGG No data
992050396_992050400 -1 Left 992050396 5:72935518-72935540 CCTCAACACCAGTGGGCTCCCGT No data
Right 992050400 5:72935540-72935562 TGCAGCCAGAGCCTCCCCGACGG No data
992050388_992050400 24 Left 992050388 5:72935493-72935515 CCTGCAGCCCACCATGCCTGAGC 0: 152
1: 882
2: 589
3: 308
4: 434
Right 992050400 5:72935540-72935562 TGCAGCCAGAGCCTCCCCGACGG No data
992050397_992050400 -9 Left 992050397 5:72935526-72935548 CCAGTGGGCTCCCGTGCAGCCAG No data
Right 992050400 5:72935540-72935562 TGCAGCCAGAGCCTCCCCGACGG No data
992050391_992050400 13 Left 992050391 5:72935504-72935526 CCATGCCTGAGCTCCCTCAACAC No data
Right 992050400 5:72935540-72935562 TGCAGCCAGAGCCTCCCCGACGG No data
992050395_992050400 0 Left 992050395 5:72935517-72935539 CCCTCAACACCAGTGGGCTCCCG No data
Right 992050400 5:72935540-72935562 TGCAGCCAGAGCCTCCCCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992050400 Original CRISPR TGCAGCCAGAGCCTCCCCGA CGG Intergenic
No off target data available for this crispr