ID: 992056124

View in Genome Browser
Species Human (GRCh38)
Location 5:72992591-72992613
Sequence CTATAGATAGGGAGAAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 447}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992056116_992056124 22 Left 992056116 5:72992546-72992568 CCCCTCTTAGGATGAGGTACAAA 0: 1
1: 0
2: 1
3: 3
4: 94
Right 992056124 5:72992591-72992613 CTATAGATAGGGAGAAAAGAAGG 0: 1
1: 0
2: 4
3: 31
4: 447
992056117_992056124 21 Left 992056117 5:72992547-72992569 CCCTCTTAGGATGAGGTACAAAG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 992056124 5:72992591-72992613 CTATAGATAGGGAGAAAAGAAGG 0: 1
1: 0
2: 4
3: 31
4: 447
992056120_992056124 -4 Left 992056120 5:72992572-72992594 CCTGGCTCATTGCCTGAAACTAT 0: 1
1: 0
2: 0
3: 12
4: 138
Right 992056124 5:72992591-72992613 CTATAGATAGGGAGAAAAGAAGG 0: 1
1: 0
2: 4
3: 31
4: 447
992056118_992056124 20 Left 992056118 5:72992548-72992570 CCTCTTAGGATGAGGTACAAAGA 0: 1
1: 0
2: 0
3: 13
4: 149
Right 992056124 5:72992591-72992613 CTATAGATAGGGAGAAAAGAAGG 0: 1
1: 0
2: 4
3: 31
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992056124 Original CRISPR CTATAGATAGGGAGAAAAGA AGG Intronic
900857628 1:5198743-5198765 CTAGTGATAAGCAGAAAAGAGGG + Intergenic
902101631 1:13995238-13995260 CTAATGATTGGGAAAAAAGATGG + Intergenic
902204785 1:14860158-14860180 CTAGAGAGAGAGAGAAAGGAGGG - Intronic
905224945 1:36472749-36472771 CCACAGACAGGGAGACAAGAGGG - Intronic
905698720 1:39995697-39995719 CTAGAGAAAGGGAGAAAGAAGGG - Intergenic
905828721 1:41047268-41047290 CTAAAGAGAGGCAGTAAAGAAGG + Intronic
906957335 1:50385916-50385938 CTATAACAAGGGAGAAATGATGG - Intergenic
906959968 1:50414279-50414301 GTAGGGAGAGGGAGAAAAGAGGG - Intergenic
909337632 1:74494012-74494034 TTCTAGATGGGGAGCAAAGAAGG + Intronic
909700985 1:78522661-78522683 CTAGTGATAAGCAGAAAAGAGGG + Intronic
910162113 1:84284437-84284459 CTCTAGATAGGAAGAAATAAAGG + Intergenic
910256468 1:85253112-85253134 CTAGTGATAAGCAGAAAAGAAGG + Intronic
910281147 1:85502938-85502960 CTATGGATAGTGAGAAAATCTGG - Intronic
910534853 1:88285750-88285772 CTATAGATATGGTGACAGGAGGG + Intergenic
910539435 1:88338792-88338814 CTACACTGAGGGAGAAAAGAAGG + Intergenic
911048110 1:93645306-93645328 CTAAAAATAAGGAGAAAATAAGG + Intronic
911705894 1:101012332-101012354 CTAGTGATAAGCAGAAAAGAGGG + Intronic
911977265 1:104515278-104515300 TTATAGGTAAGCAGAAAAGAAGG + Intergenic
913092944 1:115492281-115492303 ACCTAGATAAGGAGAAAAGAAGG + Intergenic
913714698 1:121521573-121521595 CTAAAGAGAGAGAGAAAAAAAGG + Intergenic
916275887 1:162992749-162992771 CTATAGTCAGGGAAAACAGAGGG - Intergenic
916324406 1:163540840-163540862 GCATAAATAGGGAGAAAAGAAGG + Intergenic
916336651 1:163678570-163678592 CTAAAGAAAGGAAGAAAGGAAGG - Intergenic
916772276 1:167922511-167922533 GTGTAGGTAGGGAGAGAAGAAGG + Intronic
918329789 1:183447729-183447751 ATATAAATCAGGAGAAAAGAGGG + Intergenic
918608955 1:186464645-186464667 CTATAAAAAGGTAGAAAAAAGGG - Intergenic
919431344 1:197496284-197496306 GTATGGAGTGGGAGAAAAGAAGG + Intergenic
919471464 1:197984276-197984298 GTAGAGATAGGGAGAACGGATGG + Intergenic
919879697 1:201893531-201893553 CTGTGGATGGGGAGAAAAGGAGG - Intergenic
921139505 1:212292997-212293019 CTAGTGATAAGCAGAAAAGAAGG - Intronic
921778597 1:219133068-219133090 ATATAAACAGGGAGAAAAAAAGG + Intergenic
922302091 1:224310673-224310695 CTAAAGGGAGGGAGAAAGGAAGG - Intronic
923205175 1:231752383-231752405 CAAGAGAGAGAGAGAAAAGAGGG + Intronic
923429693 1:233908152-233908174 CTATAAATGGGGAGAGATGATGG + Intronic
923675769 1:236079699-236079721 CAAAAGATAGAGAGAAAAAAGGG - Intergenic
924073510 1:240308499-240308521 CTAGTGATAAGCAGAAAAGAGGG + Intronic
1063233134 10:4085807-4085829 CTATATATAGGGGGAAGACAAGG - Intergenic
1064515878 10:16147365-16147387 CTAAAAATAGGGAGAGAGGAAGG + Intergenic
1064568620 10:16670029-16670051 TTATAATTTGGGAGAAAAGATGG - Intronic
1064981033 10:21166905-21166927 CTACAGATAAGGAAAATAGATGG + Intronic
1065010872 10:21419509-21419531 CAAAAGAGAGGGAGAAAAAAAGG + Intergenic
1065833657 10:29637917-29637939 TTATAGAAATGGAGAAGAGATGG + Intronic
1066638958 10:37536457-37536479 CTAGTGATAAGCAGAAAAGACGG + Intergenic
1066749160 10:38635291-38635313 CTACAGAAAGGTAGAAAAAATGG - Intergenic
1066967499 10:42282500-42282522 CTACAGAAAGGTAGAAAAAATGG + Intergenic
1067214548 10:44291690-44291712 CAATAGATAATGAGATAAGAGGG - Intergenic
1068468814 10:57433438-57433460 CAAGAGAGAGAGAGAAAAGAGGG - Intergenic
1069169294 10:65204957-65204979 GTATATAAAGGGAGAAAGGAAGG - Intergenic
1072948765 10:99834561-99834583 TTATAGATAGAGAGGAAGGAAGG - Intronic
1073712882 10:106065309-106065331 ATGCAGATAGGGAGCAAAGAGGG - Intergenic
1073856502 10:107681293-107681315 CAATAAAACGGGAGAAAAGAAGG + Intergenic
1074047004 10:109848408-109848430 CCATATTTAGGGAGAAAAGGTGG - Intergenic
1074592522 10:114826632-114826654 CTTTAGAGAGGCAGAGAAGATGG + Intronic
1074835057 10:117283716-117283738 ATAAAGTTAGTGAGAAAAGAGGG - Exonic
1076195465 10:128514412-128514434 ATATAGAAAGGGTGAAAATAAGG + Intergenic
1076581163 10:131512903-131512925 CCATGGATAGAGAGAAAAAAGGG - Intergenic
1077261309 11:1622435-1622457 CCATAGGTGGGAAGAAAAGATGG - Intergenic
1077385108 11:2265733-2265755 CTAGTGATAAGCAGAAAAGAGGG - Intergenic
1077734255 11:4772130-4772152 TTATAGATAGGGAGAGAGGGTGG - Intronic
1078396348 11:10985252-10985274 CTAGAGCTAGGGAGACCAGAGGG + Intergenic
1078409357 11:11099182-11099204 CTATATATAAGTTGAAAAGATGG - Intergenic
1078624537 11:12942003-12942025 CTATAGAACTGGAGAAAAAATGG - Intronic
1079294435 11:19219677-19219699 CTAGTGATAAGCAGAAAAGAGGG + Intergenic
1080542030 11:33276153-33276175 ATATAGATACAGAGAAAAAAAGG - Intronic
1081430408 11:42970480-42970502 CTCTTGAAAGGGAGGAAAGAAGG - Intergenic
1083213431 11:61203695-61203717 GAATAGAGAGGGAGAAAAAAGGG - Intronic
1083763417 11:64830903-64830925 CTTTAGAAAGAGAGAAACGAAGG - Intronic
1084635493 11:70389657-70389679 CTAGTGATAAGTAGAAAAGAGGG - Intergenic
1085699527 11:78733770-78733792 TTATAGATAATGGGAAAAGAGGG + Intronic
1085858136 11:80198977-80198999 CTATGGAGAGGGAGAGATGAGGG - Intergenic
1086649153 11:89265720-89265742 CTATGGAAAGGGAGATAACATGG - Intronic
1086668051 11:89509497-89509519 CTTTAGATAGAGATAAAAGTTGG + Intergenic
1087712988 11:101575900-101575922 CTATGAAAAGGGAGAAGAGAAGG + Intronic
1088196217 11:107276849-107276871 TTATAGATTGGGAGAAATGAGGG - Intergenic
1088271465 11:108038901-108038923 ATATAGATTAGGAGAAAAGGGGG - Intronic
1088549258 11:110994428-110994450 CTTTAGAAAGGGACAAAAGCTGG + Intergenic
1088761549 11:112933830-112933852 CTAAAGATAAGGGGAAAATAAGG - Intergenic
1088837274 11:113588397-113588419 CTCTAGAAGGGGAGAAAAGAAGG + Intergenic
1089404308 11:118184761-118184783 GTATAGATGGGCAGACAAGATGG + Intergenic
1089746582 11:120621712-120621734 CTTTAGAAAGGAAGAAAATAAGG - Intronic
1091183434 11:133627716-133627738 GTAGAGACAGGGAGAGAAGAGGG - Intergenic
1091183443 11:133627758-133627780 GTAGAGACAGGGAGAGAAGAGGG - Intergenic
1091183452 11:133627800-133627822 GTAGAGACAGGGAGAGAAGAGGG - Intergenic
1093858230 12:24131773-24131795 AAAAAGAGAGGGAGAAAAGAGGG + Intergenic
1093935715 12:24997850-24997872 CTACAAATAGGGAAAAAAGATGG + Intergenic
1094738593 12:33262601-33262623 ATTTAGATAGGCAGAGAAGATGG + Intergenic
1096005416 12:48166470-48166492 CCATAGAAAGGGAGAGAAGGGGG + Intronic
1096826646 12:54283692-54283714 CCATAGTTTGGGAGAAAGGAAGG + Intronic
1097579447 12:61436170-61436192 AGATAGATGGGGAGAAGAGAGGG - Intergenic
1097967907 12:65601007-65601029 CCATAGATCTGGAGAAAGGATGG + Intergenic
1098159162 12:67631939-67631961 CTATAGATTTGGAGGAGAGAGGG + Intergenic
1098353918 12:69591807-69591829 CTAGTGATAAGCAGAAAAGAGGG - Intronic
1101220779 12:102637580-102637602 CTATAGGTAGGGAGGAAGGAGGG - Intergenic
1102741263 12:115209478-115209500 CTCTACATAGGGAAGAAAGAAGG - Intergenic
1103163164 12:118747750-118747772 CTATAGAAAGGGAGAAGGGATGG + Intergenic
1104111659 12:125710302-125710324 TTATAGAAAGGGAGGAAGGATGG + Intergenic
1104392846 12:128405610-128405632 CTATAGACAGGCAGCAAATAGGG + Intronic
1104393583 12:128412287-128412309 CTGAAGATGGGGAGAAAAGATGG - Intronic
1105386425 13:19934054-19934076 CTATAGAAAGCGGGAAAAGTGGG - Intergenic
1107000752 13:35541926-35541948 CTAAAGATGGGGAGAAATAATGG - Intronic
1107367138 13:39693320-39693342 CTTAAGAAAGAGAGAAAAGAGGG - Intronic
1107662857 13:42657649-42657671 ATAGAGAGAGGAAGAAAAGAAGG + Intergenic
1107785229 13:43949148-43949170 ATATAGGTAGAGAGAAAAGAGGG + Intergenic
1108421944 13:50259760-50259782 CTCTAGAGAGGGTAAAAAGAAGG - Intronic
1108829805 13:54463464-54463486 CTAGAGAAAGGTGGAAAAGAGGG + Intergenic
1108898348 13:55364183-55364205 CTGAAGATAGGAAGAAAAGGTGG + Intergenic
1110134380 13:72047410-72047432 CTAGAGATATGGAGAAGATATGG + Intergenic
1110243811 13:73298674-73298696 CAAAAGATAAGGAGAAAATAAGG + Intergenic
1110280307 13:73685296-73685318 TTATAGAGATGGAGAAAGGATGG - Intergenic
1110932994 13:81246544-81246566 TTATAGAAAGGGGGAAAAAAAGG + Intergenic
1111357133 13:87122587-87122609 TTAGAAATAGGGAAAAAAGATGG + Intergenic
1112030980 13:95456238-95456260 GTAAAGACAGGGAGTAAAGATGG - Intronic
1112672969 13:101662445-101662467 CTATAGTCAGGGAGACATGAGGG + Intronic
1113673181 13:112188797-112188819 CTATAGACTGGGAGAGAGGAAGG + Intergenic
1115367798 14:32578215-32578237 AGATGGAGAGGGAGAAAAGAGGG + Intronic
1115536253 14:34376138-34376160 CAATAGAAAGGGAGAAGTGAAGG - Intronic
1116024748 14:39501592-39501614 CCAAAAAAAGGGAGAAAAGAGGG - Intergenic
1117262208 14:54047366-54047388 CTCTAGCTATGGAGAAAAGGAGG - Intergenic
1117326359 14:54672437-54672459 CTATAGATAGGTAGAAGAGGAGG - Intronic
1117982362 14:61354483-61354505 CTAAATATAGGGGGAAAAAAAGG - Intronic
1118231922 14:63959707-63959729 ACAAAGAAAGGGAGAAAAGAAGG - Intronic
1118872008 14:69750899-69750921 CTAGTGATAAGCAGAAAAGAGGG - Intronic
1120599781 14:86488495-86488517 TTTTACAGAGGGAGAAAAGAAGG - Intergenic
1121629723 14:95413467-95413489 CCACAGTTAGGGAGTAAAGAGGG - Intronic
1125245939 15:37639477-37639499 CTAAAGAAAGGAAGAAAAAAAGG + Intergenic
1125260532 15:37819443-37819465 CTAAAGATAGAGAGAAAGGGAGG + Intergenic
1126326811 15:47487684-47487706 CTATAAATAGGGAGAGAATTAGG - Intronic
1126369508 15:47930917-47930939 CTATAGAAAGGAAAAAAAGAGGG - Intergenic
1126841060 15:52717879-52717901 CTATGCATAGGTAGAAATGATGG - Intergenic
1126917796 15:53484746-53484768 CTAGTGATAAGCAGAAAAGAGGG - Intergenic
1126958152 15:53958167-53958189 GTATAGGTAGGGAGAAAAAAGGG - Intergenic
1127743948 15:61944631-61944653 CTACAGAGAGGGAGGAAAGGGGG + Intronic
1127947347 15:63768668-63768690 CTGTAGAAAGGCATAAAAGAGGG - Intronic
1128343483 15:66838896-66838918 CCATAGATAGGGAGAACTGATGG - Intergenic
1128708437 15:69854342-69854364 CTTTAAATAGAGAGAATAGAAGG + Intergenic
1129679112 15:77647985-77648007 CCAGAGAGAGGGAGGAAAGAAGG - Intronic
1132471217 16:104435-104457 CTATGGGTATGGAGAAATGAGGG + Intronic
1133319580 16:4904656-4904678 CTGTGGATAGGGAGGAAACAGGG + Intronic
1134211963 16:12285056-12285078 CTATAAACAGGCAGAAAAGTGGG - Intronic
1134814007 16:17191097-17191119 CTAGTGATAAGCAGAAAAGAGGG + Intronic
1135019650 16:18952776-18952798 ATTTAGAAAGGGAGAAAAGATGG - Intergenic
1135292732 16:21254080-21254102 CTACATAGAGGGGGAAAAGAGGG - Intronic
1135693237 16:24562518-24562540 GTTTAGATAGGTAGAGAAGAGGG + Intronic
1136733566 16:32441844-32441866 CTACAGAAAGGTAGAAAAAATGG + Intergenic
1140657461 16:77155432-77155454 CTATAGAGAGGGAAAGTAGAGGG - Intergenic
1141291863 16:82725360-82725382 CTATAGTGAGGGAGAATAGTGGG + Intronic
1141464713 16:84197844-84197866 CTCTGGATGGGGAGAGAAGATGG + Intergenic
1203019517 16_KI270728v1_random:387758-387780 CTACAGAAAGGTAGAAAAAATGG - Intergenic
1203037852 16_KI270728v1_random:660916-660938 CTACAGAAAGGTAGAAAAAATGG - Intergenic
1144962528 17:19053324-19053346 CCATAGATAGGGGGAAATGCAGG + Intergenic
1144972633 17:19121197-19121219 CCATAGATAGGGGGAAATGCAGG - Intergenic
1147483263 17:40787404-40787426 ATAAAGATACGGAGAAAACAGGG + Intergenic
1148710524 17:49677730-49677752 CTTGAGATAGGGAGAAGGGACGG + Intronic
1148971379 17:51485620-51485642 CAATAAATTGGGTGAAAAGATGG - Intergenic
1149220150 17:54407867-54407889 GTACATATAGGGAGAAAAGAGGG + Intergenic
1149223576 17:54442610-54442632 ATACAGTTAGGGAGAGAAGATGG - Intergenic
1150585064 17:66510072-66510094 CTAGTGATAAGCAGAAAAGAGGG + Intronic
1150794179 17:68224812-68224834 TGATAGATAGAGAGGAAAGAAGG - Intergenic
1150919545 17:69468750-69468772 CTAGTGATAAGCAGAAAAGAGGG - Intronic
1153493350 18:5672091-5672113 CTATAGATGGGGAAAAGAGGAGG - Intergenic
1153509780 18:5838959-5838981 CAAGAGATAGTGAGAACAGATGG - Intergenic
1153792034 18:8587459-8587481 CCACATATAGGCAGAAAAGAGGG - Intergenic
1155849968 18:30761800-30761822 GTAAAGAGAGGAAGAAAAGAAGG - Intergenic
1155861380 18:30904997-30905019 GTATAGATAGGGGGAAATAACGG + Intergenic
1156482048 18:37442477-37442499 CTCTAGAAAGGGAGAAGGGATGG + Intronic
1156618336 18:38816320-38816342 CTATCATTAGTGAGAAAAGAGGG + Intergenic
1156727095 18:40141646-40141668 CTATAGATTGAGAGAAAAGCAGG - Intergenic
1157462995 18:47918239-47918261 GTATAAGTAGGAAGAAAAGAGGG + Intronic
1157927454 18:51781806-51781828 CTAGTGATAAGCAGAAAAGAGGG + Intergenic
1158222681 18:55166497-55166519 AAATAGAAAGGGAGAAAAGCAGG - Intergenic
1158927313 18:62281025-62281047 CTAGTGATAAGTAGAAAAGAGGG - Intronic
1159469433 18:68832568-68832590 CTAGTGATAGGTGGAAAAGAGGG + Intronic
1159777138 18:72616263-72616285 CTACATATAGGGAGGAAACATGG - Intronic
1161596883 19:5155041-5155063 CTTTCGAGATGGAGAAAAGAGGG - Intergenic
1161748858 19:6079482-6079504 CTATAGAAAGGGACAGCAGATGG + Intronic
1162171755 19:8795261-8795283 CTAGTGATAAGCAGAAAAGAGGG - Intergenic
1163277335 19:16293555-16293577 CTAAAGGCAGGGAGAAAAAAAGG + Intergenic
1164659510 19:29950221-29950243 CTCTAGATTGGAAGAAAAGATGG + Intronic
1164794374 19:31014480-31014502 GACTAGAGAGGGAGAAAAGAAGG + Intergenic
1164998894 19:32744597-32744619 CTAGAAAAAGGGAGCAAAGATGG - Intronic
1165854817 19:38873292-38873314 CAATAGATAGAGAGACAGGAAGG + Intronic
1166225514 19:41392652-41392674 GCAGAGAGAGGGAGAAAAGAGGG + Intronic
1167516280 19:49924837-49924859 CAATAGCTAGAGAGAAAAGGCGG + Intronic
1167983306 19:53294277-53294299 CTAGTGATAAGCAGAAAAGAGGG + Intergenic
1168197911 19:54789187-54789209 ACATAAAGAGGGAGAAAAGAGGG + Intronic
1202646599 1_KI270706v1_random:147627-147649 CTATAGAATGTGAGAACAGAAGG + Intergenic
925527312 2:4817206-4817228 CTCTAGCTAGGAAAAAAAGATGG + Intergenic
925944514 2:8848362-8848384 CTATCGATAGAAAAAAAAGATGG - Intergenic
926514184 2:13820739-13820761 CTTTATATATGGACAAAAGAAGG - Intergenic
927056613 2:19371289-19371311 GTATAAATAGGTAGAAGAGAAGG - Intergenic
928096302 2:28407154-28407176 CTAATGAGAGGCAGAAAAGAAGG - Intronic
929610105 2:43264696-43264718 CTCTGGATTGGGAGAAAAGAAGG + Intronic
930118738 2:47742363-47742385 CAATAGATAATGAGAAAACAGGG - Intronic
930251441 2:49038892-49038914 CAATAGAGAAGGAGAAAAGAAGG + Intronic
930506968 2:52294735-52294757 CAATAGATAGTGAGATAACAGGG - Intergenic
932808715 2:74806003-74806025 CATTAAACAGGGAGAAAAGAGGG + Intergenic
932809768 2:74815044-74815066 CTGTAGAGAGGGAGAAAAGCGGG - Intergenic
933409565 2:81908799-81908821 AAATAGAGAGGGAGGAAAGAAGG - Intergenic
934312153 2:91877424-91877446 CTACAGAAAGGTAGAAAAAATGG - Intergenic
935014968 2:99173239-99173261 GTATAGAGAGGAAGAAAAGCTGG + Intronic
937278085 2:120698955-120698977 CTGTAGAAAGTGAGAAGAGAGGG - Intergenic
937593831 2:123648662-123648684 CTATAGGTAGGAAGAGCAGATGG + Intergenic
937651456 2:124323940-124323962 TTAGAGACAGAGAGAAAAGAAGG + Intronic
938593257 2:132761050-132761072 CAATAGCTGGGGAAAAAAGAGGG - Intronic
938876948 2:135541554-135541576 CCAAAGAGAGGGAGAAGAGATGG + Intronic
939520710 2:143226331-143226353 CTATAGATAGGATGCAAATAAGG + Intronic
939555821 2:143671727-143671749 AGATAGATAGGGATAAATGATGG - Intronic
939566430 2:143791095-143791117 CTCTTGAGAGGAAGAAAAGAAGG + Intergenic
939642132 2:144653268-144653290 CTACAGAGAGGGAGAAGAAAGGG - Intergenic
940098575 2:150007074-150007096 CTTTAAATAGGGAGGAAAGGAGG - Intergenic
940610856 2:155989817-155989839 CTACAGAGGGGGAGAAAGGATGG - Intergenic
943388905 2:187236774-187236796 TTATAGATAGAAAGCAAAGAAGG - Intergenic
946051354 2:216865155-216865177 TTATAGATGGGGATAAAGGAAGG - Intergenic
946184485 2:217971921-217971943 TAATAGAGAGAGAGAAAAGAAGG + Intronic
946807413 2:223485113-223485135 CTATAGAGAAAGAGAAAACAAGG - Intergenic
946897604 2:224340311-224340333 CTATATCTTGGCAGAAAAGAGGG - Intergenic
947441388 2:230124837-230124859 CTATAAATATGAAGAAAAGCTGG + Intergenic
948022653 2:234748814-234748836 CCAAAGAAAGGGAGAAAGGAGGG + Intergenic
1169178735 20:3543099-3543121 CTTTAGAAAGGGTGAAAGGAAGG - Intronic
1169612958 20:7403771-7403793 CAAGAGATAGGGAGAAAAGAGGG + Intergenic
1169767211 20:9159971-9159993 CCATAGTTAGGGAGAAGAGGTGG + Intronic
1170074615 20:12405867-12405889 CTCAACATAGGGAGAAAATAAGG + Intergenic
1173215505 20:41078501-41078523 CTTTAGACAAGGAGAAAAGCAGG + Intronic
1173530930 20:43769152-43769174 CTATAGAAAGGGAGGGAAGGAGG + Intergenic
1173848008 20:46200273-46200295 CTAAAGAAAGAAAGAAAAGAGGG - Intronic
1173854097 20:46238822-46238844 GAATAGATGGGCAGAAAAGAGGG - Intronic
1174979298 20:55375212-55375234 CTATAGAAATGGAAACAAGAAGG - Intergenic
1175039198 20:56029863-56029885 CTGTGGATACAGAGAAAAGATGG + Intergenic
1175670782 20:60901093-60901115 CTACGGATAGGCAGAAAGGAGGG - Intergenic
1175683765 20:61011123-61011145 CTATAGAGAGAGAGAGGAGAAGG - Intergenic
1176723450 21:10411968-10411990 CCAGAGAGAGGGAGAAAACACGG - Intergenic
1177611057 21:23449088-23449110 ATATAGACAGGCAGATAAGAAGG + Intergenic
1177778636 21:25598698-25598720 ATATTGAGAGGGAGAGAAGAGGG - Intronic
1177955090 21:27588376-27588398 ATATAGAAAGAGAGAAAGGAAGG + Intergenic
1178079731 21:29051180-29051202 GGATATATAGGGAGAAAAGCAGG + Intronic
1178728956 21:35081391-35081413 CTATAGATGGGGAGAAGAGAAGG - Intronic
1178799251 21:35777188-35777210 TGATAGAAAGGGAGAGAAGACGG - Intronic
1178811921 21:35892285-35892307 AGAAAGATAGGGAGCAAAGAAGG + Intronic
1179315350 21:40239095-40239117 CTAGAGATAGGGAGAAATGATGG - Intronic
1180304607 22:11064737-11064759 AGAGAGAGAGGGAGAAAAGACGG - Intergenic
1180538913 22:16423239-16423261 CTACAGAAAGGTAGAAAAAATGG - Intergenic
1181561552 22:23705661-23705683 CCAGAGATTGGGGGAAAAGAGGG + Intergenic
1181817350 22:25448477-25448499 ATATAGATGGGGAGAGAGGAAGG + Intergenic
1182183207 22:28372965-28372987 CTATATATTAGAAGAAAAGAGGG - Intronic
1184127599 22:42499362-42499384 CTATAAATAGGGGGAGAAAATGG - Intergenic
1185373513 22:50471549-50471571 CTATAGGAAAAGAGAAAAGAAGG + Intronic
949453795 3:4216607-4216629 CTACAGAATGGGAGAAAAAAGGG + Intronic
949753528 3:7382105-7382127 TTAGAGACAGAGAGAAAAGAAGG - Intronic
950617367 3:14171871-14171893 CTAGAGAAAAGGAGAAGAGATGG + Intronic
951408293 3:22328261-22328283 CTGTAGAAGGGGAGAAAAAAAGG - Intronic
951651302 3:24954652-24954674 CAATAGAGAGGGAGAGAAGGGGG + Intergenic
951922547 3:27872343-27872365 CTAGTGATAAGCAGAAAAGAGGG + Intergenic
952082664 3:29779396-29779418 CTATACAGATGGAGAAAATATGG - Intronic
952187720 3:30988624-30988646 AAATAAATTGGGAGAAAAGAGGG + Intergenic
952307955 3:32162024-32162046 CTATAGCAATGGAGAAGAGAAGG - Intronic
953160466 3:40415005-40415027 ATATAGCTGGGGAGAAAACATGG + Intronic
953685482 3:45074853-45074875 TTAGAGATTGGGAGAAAAGGGGG + Intergenic
955355819 3:58231759-58231781 CTCAGGATAGGAAGAAAAGATGG - Intergenic
956036530 3:65098607-65098629 CTATAGAGAGCAAGAATAGAGGG - Intergenic
956225892 3:66957693-66957715 TTTTAGATAGTGACAAAAGAGGG - Intergenic
956514712 3:70034019-70034041 CTATATTTAGGGAGAAAAAATGG + Intergenic
956714369 3:72065241-72065263 AAAGAGAGAGGGAGAAAAGAGGG + Intergenic
956977654 3:74600275-74600297 CTATAAATGTGGAGAAAAGTGGG + Intergenic
957218070 3:77347516-77347538 ATATAGATAGGGAGAGATAAGGG - Intronic
957260998 3:77901072-77901094 GGATAGATAGATAGAAAAGAAGG + Intergenic
957597999 3:82292516-82292538 CTATAAATAGGGACAAGAAAAGG - Intergenic
958414894 3:93862129-93862151 ATATAGAGAGAGAGATAAGAGGG + Intergenic
958596370 3:96229949-96229971 TGATAGATGGGGAGAAAATAGGG + Intergenic
958985705 3:100777283-100777305 CTGGAGAGAGGGAGGAAAGATGG + Intronic
959302940 3:104625696-104625718 ATATATATATGGTGAAAAGATGG - Intergenic
959416179 3:106078743-106078765 CTATAGGGAGGGAGGAAGGAAGG - Intergenic
959561614 3:107788972-107788994 CATTAGAGAGGGAGAAATGATGG + Intronic
959602527 3:108203866-108203888 CCATAGACAGGGAGAAAATGCGG + Intronic
959917391 3:111831057-111831079 AGAGAGATAGAGAGAAAAGAAGG + Intronic
960259842 3:115554367-115554389 CTTTAGATAGGGAGACTTGATGG + Intergenic
960526862 3:118719727-118719749 CTATAAATAGGGAGAGTAAAGGG - Intergenic
960868711 3:122228237-122228259 CTAGACCTAGGAAGAAAAGATGG - Intronic
962409150 3:135126361-135126383 CTAAAGAGAGAAAGAAAAGAGGG + Intronic
962751398 3:138436841-138436863 ATACAGAAGGGGAGAAAAGAAGG - Intronic
962760282 3:138506046-138506068 ATATAGATAGTGAGCAAATATGG - Intronic
963659087 3:148101536-148101558 CTGTAGAGAGGGAGAAAAAGTGG + Intergenic
964578844 3:158207311-158207333 GAAGAGAGAGGGAGAAAAGAAGG - Intronic
964682518 3:159358158-159358180 CTAAAGAGAGGGAGGTAAGAAGG + Intronic
965475092 3:169147112-169147134 CAAGAGAAAGTGAGAAAAGAGGG - Intronic
965514545 3:169606788-169606810 CTGCAGGAAGGGAGAAAAGAGGG + Intronic
966755461 3:183366930-183366952 CTGTAAATAGGGAAAAAAGAAGG + Intronic
967301193 3:188015524-188015546 CTATAGAAAGGTAGGAAAAAAGG - Intergenic
969057808 4:4413223-4413245 CTATAGACAGACAGGAAAGAGGG + Intronic
969201411 4:5609204-5609226 ACATAGATAGGGAGGTAAGAGGG - Intronic
969271067 4:6102698-6102720 CTTTAGAGAGGGAGAAAAAAGGG - Intronic
970573106 4:17402062-17402084 CTATAAAATGGGAGAAATGATGG - Intergenic
970665312 4:18329872-18329894 GTATAGAAAGGAAGAAAAGAGGG + Intergenic
971485140 4:27151998-27152020 TTATAGATAAAGATAAAAGATGG - Intergenic
971594420 4:28510294-28510316 GTATAGAAAGGGGGAAAAAAAGG - Intergenic
971775547 4:30960055-30960077 ATATAGATAGTTAGAAAAGGAGG + Intronic
972174583 4:36388055-36388077 CTACTCATAGGGAGAAAATATGG - Intergenic
973159243 4:46994409-46994431 CTTTAGGTAGGGGGAAAGGACGG + Intronic
973716543 4:53682429-53682451 CAATGCATAGGGAGAAAAGGTGG - Intronic
973843230 4:54884463-54884485 CTGCATATAGGGTGAAAAGAAGG + Intergenic
975231479 4:71939356-71939378 ATAGAGAGAGGGAGAGAAGATGG - Intergenic
977088686 4:92640976-92640998 CTAGTAATAGGAAGAAAAGAAGG + Intronic
977419408 4:96778953-96778975 GTAAAGACAGGGAGAGAAGATGG + Intergenic
977879199 4:102184856-102184878 GAAGAGATATGGAGAAAAGATGG - Intergenic
978372780 4:108045965-108045987 CTAGAGATAGGGATCAAAGCAGG - Intergenic
978437229 4:108698662-108698684 CTAAAGAGAGGGTGGAAAGAGGG - Intergenic
978447524 4:108794498-108794520 CTATTGATAGGAAAAAAATATGG - Intergenic
978458035 4:108917223-108917245 TTATTGATAGAAAGAAAAGATGG + Intronic
978614413 4:110579726-110579748 CTTAAGATAGGGTGAAAGGAAGG - Intergenic
978914234 4:114104387-114104409 CTATATATTTGGAGAAAAAAAGG - Intergenic
979627044 4:122856878-122856900 TTATAGAAATGGAGAACAGATGG - Intronic
979947891 4:126857163-126857185 ATATAGAAAGGGAAAAAAAATGG + Intergenic
980030792 4:127827206-127827228 TGATAAATAGGAAGAAAAGATGG - Intronic
981660971 4:147166250-147166272 CTATAGATAAGGAGATTTGAAGG - Intergenic
981804972 4:148704489-148704511 CTATAGGTAGGGAAAATAGAAGG + Intergenic
982047476 4:151463266-151463288 CCAGAGGTAGGAAGAAAAGATGG - Intronic
982368561 4:154607611-154607633 CTATAGAGTGGGGGAAAGGATGG + Intronic
982837093 4:160132351-160132373 TTTCACATAGGGAGAAAAGATGG + Intergenic
982967192 4:161926320-161926342 CTAAAATAAGGGAGAAAAGAAGG - Intronic
983470943 4:168153353-168153375 CTAGTGATAAGCAGAAAAGAGGG - Intronic
984202927 4:176748505-176748527 ATATAGAAACGAAGAAAAGAAGG + Intronic
984332152 4:178337574-178337596 CCAAAAATAGGGAGAAAGGAAGG + Intergenic
985054366 4:186023514-186023536 CTATAAAAAAGGAGGAAAGACGG - Intergenic
985244298 4:187964534-187964556 ATATAGAAAGGAAGCAAAGATGG - Intergenic
985395802 4:189542318-189542340 TTTTATATATGGAGAAAAGAAGG - Intergenic
986009992 5:3705304-3705326 CTTTAGTTAGGAAGAAAATATGG - Intergenic
987314663 5:16713204-16713226 ATAGAGACTGGGAGAAAAGAGGG - Intronic
987632988 5:20500178-20500200 CTATAGAACTGTAGAAAAGAAGG - Intronic
988044503 5:25932476-25932498 CTATGGTTAGGGAAAAAAAAAGG + Intergenic
988431012 5:31118614-31118636 CCATAGAATGGGAGAGAAGATGG - Intergenic
988482883 5:31644298-31644320 CTTTAGAAATAGAGAAAAGATGG + Intronic
989059394 5:37395402-37395424 CTAGTGATAAGTAGAAAAGAGGG + Intronic
989329869 5:40244210-40244232 CCAGATATGGGGAGAAAAGAAGG + Intergenic
989672419 5:43934651-43934673 GAACAGATGGGGAGAAAAGAGGG - Intergenic
990211533 5:53484929-53484951 CTAGAGAAAGGGAGAAAAGGGGG + Intronic
990636154 5:57730008-57730030 CTATAGATATTGAGTAAAAAGGG + Intergenic
991321570 5:65379320-65379342 CTATAAAAATGGAGCAAAGATGG - Intronic
992056124 5:72992591-72992613 CTATAGATAGGGAGAAAAGAAGG + Intronic
992176559 5:74154945-74154967 CTGTAGGTGGGGAGCAAAGAGGG + Intergenic
993111931 5:83668249-83668271 CTACAGAGAGAAAGAAAAGAAGG + Intronic
993485705 5:88481439-88481461 CAAGAGAGAGGGAGAAAAAAGGG + Intergenic
993747443 5:91618628-91618650 CTTAAAAAAGGGAGAAAAGAAGG - Intergenic
993802977 5:92367538-92367560 ATGTAGATAGGGAGAAGAAATGG - Intergenic
993849645 5:92990893-92990915 CCATTGAGAGGGAGAACAGAGGG - Intergenic
993918695 5:93773094-93773116 CTAAAGTTAGAGGGAAAAGAAGG - Intronic
994681626 5:102894880-102894902 CAGTAGAGAAGGAGAAAAGAGGG - Intronic
994893470 5:105669777-105669799 CTAGTGACAGGCAGAAAAGAGGG - Intergenic
994924443 5:106096528-106096550 CTAAACATAGGGAGAGATGAGGG - Intergenic
994994150 5:107038335-107038357 GAATAGATGAGGAGAAAAGAAGG - Intergenic
995168557 5:109078199-109078221 CTGTATATAGGGAGTATAGAGGG - Intronic
997383636 5:133455632-133455654 GTCTAGATGGAGAGAAAAGAAGG + Intronic
997650679 5:135516079-135516101 CTATAGACTGGGAGAAAATATGG - Intergenic
998555641 5:143120895-143120917 CTATAAATAGGAAGATAGGAAGG + Intronic
998589250 5:143460092-143460114 CTATACTGAGGAAGAAAAGAAGG + Intergenic
1000984186 5:167849247-167849269 CTTGAGATAAGGAGATAAGAGGG - Intronic
1001497466 5:172199614-172199636 CTAAAAAGAGGAAGAAAAGATGG + Intronic
1001981184 5:176037888-176037910 CCAGGGAGAGGGAGAAAAGACGG + Intergenic
1002236275 5:177806178-177806200 CCAGGGAGAGGGAGAAAAGACGG - Intergenic
1003578672 6:7319821-7319843 GTATTGTGAGGGAGAAAAGAGGG - Intronic
1003831798 6:10020095-10020117 CTAAAGTTAGGAAGAAAAAAGGG - Intronic
1004573411 6:16869825-16869847 CTTGTGATAGGGAGCAAAGAAGG - Intergenic
1004658148 6:17684821-17684843 CCAGAAAGAGGGAGAAAAGAGGG + Intronic
1005213596 6:23498480-23498502 CTACACATAGAGAGGAAAGATGG - Intergenic
1005257702 6:24021765-24021787 CAAAAGAGAGAGAGAAAAGAAGG - Intergenic
1006707971 6:36038367-36038389 CCAAATATAGGGAGAAAAGTGGG + Intronic
1007853244 6:44825785-44825807 AGATAGATAGGAAAAAAAGAAGG - Intronic
1008193157 6:48485021-48485043 CCAGAGAGTGGGAGAAAAGAGGG - Intergenic
1008395374 6:51000373-51000395 CTATAGATAGAGAGAGGAGCAGG - Intergenic
1009042893 6:58202009-58202031 ATATAAATAGGGAGAAAAATAGG + Intergenic
1009598750 6:65771358-65771380 ATATAGATTGGGAGCCAAGATGG + Intergenic
1009673257 6:66784710-66784732 CTAAAGAGAGAGAGAAAAAAGGG + Intergenic
1011406533 6:87021362-87021384 CTATAATTAAGGAGAAAAGAAGG + Intergenic
1011419147 6:87153639-87153661 CTATAGAAAGAAAGAAAAAATGG - Intronic
1012241253 6:96875505-96875527 CAGTAGAAATGGAGAAAAGATGG - Intergenic
1012686229 6:102253418-102253440 CTGTTCAAAGGGAGAAAAGATGG - Intergenic
1012889506 6:104882706-104882728 CTACAGGTAGGGGGAAATGAAGG - Intergenic
1012936787 6:105376413-105376435 CTCTAGGTAGAGAGAAATGATGG - Intronic
1015132767 6:129832547-129832569 GTATAGTAAGGGAGAAAATACGG + Intronic
1015490645 6:133821577-133821599 CCAGACAGAGGGAGAAAAGAAGG + Intergenic
1017027207 6:150191918-150191940 GTGTAGATAGGGAAAGAAGAGGG + Intronic
1018568053 6:165178138-165178160 CTATAAATAGGAAGAAAATGTGG - Intergenic
1019928151 7:4206566-4206588 CTAGAGATGGGGAGAAAGGAAGG + Intronic
1020804891 7:12776868-12776890 ATATAGATAGGGAAAAGATAGGG + Intergenic
1020852332 7:13371720-13371742 ATAGAGATAGAGAGAATAGAGGG - Intergenic
1020938081 7:14493229-14493251 CTGTAGATAAGGGGAAAACATGG - Intronic
1021708368 7:23390659-23390681 CTATGAAGAGGGAGAAAAGGGGG - Intronic
1022435837 7:30384131-30384153 CTAGTGATAAGCAGAAAAGAGGG - Intronic
1022816880 7:33922559-33922581 CTAGTGATAAGCAGAAAAGAGGG + Intronic
1022930082 7:35102320-35102342 ATAAAGACAGGAAGAAAAGAAGG + Intergenic
1023218420 7:37891709-37891731 CTAGTGATAAGCAGAAAAGAAGG - Intronic
1023465258 7:40447675-40447697 CTATATGTAGGCAGAAGAGAAGG + Intronic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1024130395 7:46346124-46346146 CAATAGATAGGGAGATGGGAAGG + Intergenic
1024492881 7:50006135-50006157 CTAAAGATATGGAGCAAATATGG + Intronic
1025934299 7:66022341-66022363 CTAGAGGGAGGGAGGAAAGAAGG + Intergenic
1026190429 7:68121056-68121078 GTATAGATGGAGAGAAAAAATGG - Intergenic
1027433936 7:78144065-78144087 CTATAGATAGGGAAAATGTAAGG - Intronic
1027693570 7:81379550-81379572 CTATAAATAGAAAGAAAAGGGGG + Intergenic
1027973977 7:85125210-85125232 ATATACATAGGCAAAAAAGAGGG + Intronic
1028198897 7:87937603-87937625 CCATAAATGGGGAGAAAAGGAGG - Intronic
1028339511 7:89701294-89701316 CTCTAGATTGGGAGAAATGTAGG + Intergenic
1028342754 7:89742649-89742671 CTATAGCTAGAGACAAAAAATGG + Intergenic
1028912182 7:96220975-96220997 ATAGAGAGGGGGAGAAAAGAAGG - Intronic
1028976648 7:96922164-96922186 GTATAGTTAGGGAGACAAGTTGG + Intergenic
1029825977 7:103194831-103194853 ATAAAGACAGGAAGAAAAGAGGG + Intergenic
1029984231 7:104907633-104907655 CTATACCTAAGGAGAAAACATGG + Intergenic
1030328510 7:108247835-108247857 CTGGAGAAAGGGAGGAAAGAGGG + Intronic
1030443250 7:109615744-109615766 ATAGAGATAGGAAGAAAACAAGG + Intergenic
1031362664 7:120865469-120865491 CTAGAGATGGGGAGAGAAGGAGG + Intergenic
1031769429 7:125824453-125824475 CTATAGACAGAGAAAAAAAAGGG + Intergenic
1032552763 7:132800770-132800792 CCAGAGAGAGGGAGAAGAGAGGG + Intronic
1032819995 7:135515452-135515474 GTAAAGATAGGGGGAAAAAAAGG + Intergenic
1033938029 7:146613067-146613089 CTATAGATAGGGAAAATATAAGG - Intronic
1034059538 7:148073982-148074004 CCATAGATAGCGAGAGATGACGG + Intronic
1034727722 7:153354572-153354594 CTATTACTAGGGATAAAAGAGGG - Intergenic
1035447469 7:158952604-158952626 CTGTGGACAGGGAGAAAAGGAGG + Intronic
1036091711 8:5672736-5672758 ATATATATAGTGAGAAAAAATGG + Intergenic
1037071587 8:14656668-14656690 AGAGAGAAAGGGAGAAAAGAAGG - Intronic
1037728898 8:21506960-21506982 CTCTGGAGAGGGAGAAAGGAGGG + Intergenic
1038626427 8:29197686-29197708 CTAGTGATAAGCAGAAAAGAAGG - Intronic
1039713236 8:40080317-40080339 CTCTAAAGAGGGAGAAGAGAAGG + Intergenic
1039750622 8:40475002-40475024 CAATAAAGAAGGAGAAAAGATGG + Intergenic
1040841455 8:51789480-51789502 TTATATAGAGGGAGAAAAAAAGG + Intronic
1041178556 8:55223260-55223282 CTATAGATCTGGAGAAGGGAAGG - Intronic
1042690440 8:71492350-71492372 CTAAGAATAGGGAGAAGAGATGG + Intronic
1043339011 8:79214773-79214795 CTATATACATGGAGAGAAGATGG - Intergenic
1043379559 8:79688006-79688028 CTAGTGATAAGCAGAAAAGAGGG - Intergenic
1043427396 8:80161194-80161216 GTATACATAGGTAGAAGAGACGG - Intronic
1043622410 8:82211661-82211683 GTTAAGATAGAGAGAAAAGATGG + Intergenic
1045229081 8:100283378-100283400 CCATAGTTAGGGAGAAAAATTGG - Intronic
1046409903 8:113828125-113828147 ATATAGGTAGGGAAAGAAGAAGG - Intergenic
1046877718 8:119274992-119275014 CTTTAAATTGGGAGAAGAGAGGG + Intergenic
1048246027 8:132800931-132800953 CTGTAGGTAGGGAGAAAAAGAGG - Intronic
1048529049 8:135230940-135230962 CAATAAAGAGGGAGATAAGAGGG - Intergenic
1050114387 9:2248608-2248630 CTATGGATCAGGAGAAAAGAGGG - Intergenic
1050651437 9:7781198-7781220 ATATATACAGGGAAAAAAGAAGG - Intergenic
1050760171 9:9059028-9059050 TTATACTTAGGGAGAAGAGAAGG + Intronic
1051024158 9:12586966-12586988 GTCTACAGAGGGAGAAAAGAGGG - Intergenic
1051370964 9:16358694-16358716 CTAGTGATAAGCAGAAAAGAGGG - Intergenic
1051377285 9:16415266-16415288 CTATGGAAAGAGAGAAAAAAAGG - Exonic
1052434579 9:28409871-28409893 CGATAGAGAGGGAGAAAGGCAGG + Intronic
1052525063 9:29606768-29606790 CTGTATATAGTGAGAAAAGGCGG - Intergenic
1052968119 9:34357513-34357535 CTAAAATTAGGAAGAAAAGAAGG - Intergenic
1053079690 9:35164731-35164753 TTTTAGATAGGCAGAAAATATGG - Intronic
1053380401 9:37644632-37644654 CTATTGTTGGGGAGGAAAGATGG - Intronic
1053885599 9:42643472-42643494 CCAGGGAGAGGGAGAAAAGACGG - Intergenic
1054224618 9:62450921-62450943 CCAGGGAGAGGGAGAAAAGACGG - Intergenic
1054977548 9:71165616-71165638 CTACAGATTGAGGGAAAAGAGGG - Intronic
1055078879 9:72246951-72246973 CTACTGATAAGCAGAAAAGAGGG - Intronic
1055498098 9:76875813-76875835 ACATAGATAGGAAGAAAGGATGG - Intronic
1056099216 9:83284772-83284794 CTACAGAAAGGGAGAAAAGAGGG + Intronic
1056112699 9:83411367-83411389 CAATAGCTAGAGAGAAAAGGAGG + Intronic
1058721837 9:107771567-107771589 CTACAAATAGAGAGAAAAGAAGG + Intergenic
1059626120 9:116068397-116068419 AGACAGAGAGGGAGAAAAGAAGG - Intergenic
1060278587 9:122200517-122200539 CTAGTGATAAGCAGAAAAGAGGG - Intergenic
1060771384 9:126334649-126334671 CTGTAGAGAAGGAGAAAAAAAGG - Intronic
1203553021 Un_KI270743v1:180108-180130 GTATAGAGAGGGAGAGAAGTAGG + Intergenic
1185712812 X:2317587-2317609 GTATAGAAAGGGAAAAAAGCAGG + Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1190231177 X:48583218-48583240 CGACAGATAGGGAAACAAGAGGG - Intergenic
1190323982 X:49195407-49195429 CATGAGATAGGGAGAAAACAAGG - Intronic
1190466475 X:50729145-50729167 CCATACATAGGAAGAAAAGCAGG + Intronic
1190522141 X:51291194-51291216 CAGTAGAAAGAGAGAAAAGAAGG - Intergenic
1190716845 X:53111755-53111777 CTAGTGATAAGCAGAAAAGAGGG - Intergenic
1193630239 X:83876629-83876651 CTATAGATATGGCCACAAGAAGG - Intronic
1194568309 X:95521494-95521516 CAGTAGAAAGGGAGAAAAGGAGG + Intergenic
1195240863 X:102950478-102950500 CTGTTGATAGGGAGATAACAAGG - Intergenic
1195496463 X:105541001-105541023 CAATATATATGAAGAAAAGAGGG - Intronic
1195722882 X:107883585-107883607 CCATAGATTGTGTGAAAAGAGGG - Intronic
1196141413 X:112266931-112266953 CCTTAGATAGGGAGCAGAGATGG - Intergenic
1196871852 X:120120218-120120240 CTAGAAAAAGGGAGAAAAGGTGG + Intergenic
1196987837 X:121294566-121294588 CTAAAGAAAAGTAGAAAAGAAGG - Intergenic
1197078504 X:122382249-122382271 CAATATTTAGGGAGAAAACATGG - Intergenic
1197129506 X:122988815-122988837 CTGTAGCAATGGAGAAAAGATGG - Intergenic
1197230275 X:123996543-123996565 CTATGGTTGGGGAGGAAAGAAGG - Intronic
1197263509 X:124341660-124341682 CTCTATAAAGGGAAAAAAGAGGG + Intronic
1197494303 X:127158647-127158669 CTGGGGAGAGGGAGAAAAGATGG + Intergenic
1198394829 X:136210145-136210167 CTGTAAAATGGGAGAAAAGACGG - Exonic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198832792 X:140768962-140768984 CCATAGATAGAAAGGAAAGAGGG + Intergenic
1199158203 X:144574586-144574608 CTGTAGATAAGCAGAAGAGAAGG - Intergenic
1201180124 Y:11334895-11334917 CTACAGAAAGGTAGAAAAAATGG - Intergenic
1201461906 Y:14234972-14234994 CCAAAGATTGGGAAAAAAGAAGG - Intergenic
1201597074 Y:15682140-15682162 GAATAGATAGGAAGAAAGGAAGG - Intergenic