ID: 992059037

View in Genome Browser
Species Human (GRCh38)
Location 5:73023738-73023760
Sequence TTTAACACACAGAAATATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 402}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992059036_992059037 -10 Left 992059036 5:73023725-73023747 CCAAACACATTTATTTAACACAC 0: 1
1: 0
2: 4
3: 41
4: 415
Right 992059037 5:73023738-73023760 TTTAACACACAGAAATATGTTGG 0: 1
1: 0
2: 1
3: 25
4: 402
992059035_992059037 21 Left 992059035 5:73023694-73023716 CCATCTCAAAAAAAAAAAAAAGT 0: 1282
1: 11795
2: 108164
3: 76399
4: 97564
Right 992059037 5:73023738-73023760 TTTAACACACAGAAATATGTTGG 0: 1
1: 0
2: 1
3: 25
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992059037 Original CRISPR TTTAACACACAGAAATATGT TGG Intronic
902185463 1:14721673-14721695 TTGAAAACCCAGAAATGTGTTGG - Intronic
904067230 1:27763043-27763065 TTTAAAACACAGGAATGTTTTGG + Intronic
906365937 1:45209703-45209725 TTAACCAGACAGAAATATGTAGG + Intronic
907776228 1:57518485-57518507 TTTAAAACACGGAATAATGTGGG - Intronic
907847979 1:58227111-58227133 TTTCAAACGCAGAAATATCTGGG + Intronic
908207394 1:61865057-61865079 CATAACACAGAGAAAAATGTGGG - Intronic
908253891 1:62286797-62286819 TTAAACAAACGGAAATCTGTCGG + Intronic
909204206 1:72732610-72732632 TTTAGCAGAGAGAAATGTGTGGG + Intergenic
911075837 1:93874049-93874071 TATACCACACAGAAACATCTAGG - Intronic
911740334 1:101380003-101380025 TTTAAGACACAGACATATTTGGG + Intergenic
911830668 1:102546839-102546861 TATAATACACAGAAATTTATTGG + Intergenic
912028827 1:105213645-105213667 TATAACACACAAAAATTTGGGGG + Intergenic
912329827 1:108808796-108808818 TTTAACACCCAAAAAGCTGTTGG + Exonic
913063819 1:115231593-115231615 TTTATCAAACAAAAAAATGTAGG + Intergenic
913249372 1:116899710-116899732 GTTAAGACACTGAAATATGGGGG - Intergenic
913331732 1:117673199-117673221 TTTAACACAGATATACATGTGGG - Intergenic
914897141 1:151686532-151686554 GCTAGTACACAGAAATATGTTGG - Intronic
916254865 1:162776557-162776579 ATTAACACACATAAAAATTTAGG + Intronic
916297083 1:163231163-163231185 TTTAAAAAAGAGAAAAATGTGGG - Intronic
916695066 1:167226501-167226523 TTTAGAACACAGAAATACTTCGG - Intronic
916792061 1:168134006-168134028 TTTAAAACACAGTAACATATAGG - Intronic
917545395 1:175961532-175961554 TTTAACAGAAAGAAATAGGCTGG + Intronic
918390738 1:184058440-184058462 TTTAACAAATGGAAATGTGTGGG + Intronic
919530212 1:198708244-198708266 CTTACCACACTGAAATCTGTAGG - Exonic
919615226 1:199799049-199799071 TTAAACACACACACATATTTAGG - Intergenic
920427666 1:205891124-205891146 TTAAAGACACAGAAATATAGAGG - Intergenic
920528920 1:206687506-206687528 TTTAACACAAAGACGTGTGTGGG - Intronic
921233237 1:213095607-213095629 ATACACACACAGAAATATATAGG + Intronic
921233351 1:213096888-213096910 ATATACACACAGAAATATATAGG + Intronic
921369956 1:214412024-214412046 TTTAACAAACAGATAGATATAGG - Intronic
922631566 1:227119154-227119176 ATTAACAAATAGAAAAATGTTGG - Intronic
922690703 1:227687456-227687478 TTCAACACACTGAGAAATGTAGG + Intergenic
1063075040 10:2707344-2707366 CATAACACACCAAAATATGTAGG - Intergenic
1066219694 10:33323197-33323219 TTTAAAACACAGAAGGATGGGGG - Intronic
1066320141 10:34294905-34294927 TTTAACACACAGAGAAAGCTGGG + Intronic
1067581145 10:47446833-47446855 TTTTTCAAAAAGAAATATGTAGG + Intergenic
1068188398 10:53617627-53617649 ATTAATATAGAGAAATATGTGGG + Intergenic
1068327212 10:55508499-55508521 TTTAACTCACAGTTTTATGTGGG + Intronic
1068510649 10:57961608-57961630 CTTACCACATAGAATTATGTAGG + Intergenic
1068790364 10:61023744-61023766 TTTGCCACACAGGAATCTGTAGG + Intergenic
1068906716 10:62334369-62334391 TTTAAGAAATAGAAATATGGTGG + Intergenic
1069293930 10:66819815-66819837 TTTAAAACACAGAAATAAAAAGG + Intronic
1071187486 10:83060973-83060995 TTTAAGACACAGAAAGAGGGTGG - Intergenic
1071210458 10:83336163-83336185 GTTCACATAAAGAAATATGTGGG + Intergenic
1072076065 10:91975309-91975331 TTTAACATACACAAATAAGTAGG + Intronic
1072258941 10:93648904-93648926 TTTTACACATAGAAATGTGAAGG + Intronic
1073173702 10:101536354-101536376 TAACTCACACAGAAATATGTAGG - Intronic
1073783479 10:106864431-106864453 TCTAACACACAGAGCTAAGTGGG + Intronic
1074308089 10:112297633-112297655 GTTCACACACAGAAATGTGTTGG + Intronic
1075850700 10:125584424-125584446 TTTAACAGCCATTAATATGTTGG + Intronic
1077676156 11:4194378-4194400 TTTAAGTCAAAGAAAAATGTAGG - Intergenic
1078393709 11:10958660-10958682 TGTTACACACAGGAACATGTAGG - Intergenic
1079429792 11:20378473-20378495 TTTAAAACACTGACACATGTGGG + Intronic
1080214524 11:29826154-29826176 TTTTTCACACAGAATTTTGTGGG + Intergenic
1081024003 11:37985679-37985701 TTTTACACACATATATATGAAGG - Intergenic
1082650336 11:55783241-55783263 TTTAATACACAGAAAAAAATCGG - Intergenic
1085063225 11:73467981-73468003 ATTAACATTCAGAAATATATTGG - Intronic
1086651737 11:89299939-89299961 TTTAAGACAGAGAAACATTTGGG + Intergenic
1086968779 11:93057744-93057766 TTTCAAAATCAGAAATATGTAGG + Intergenic
1087325373 11:96715213-96715235 TTTAACACACTGAAATAACAAGG - Intergenic
1088832160 11:113546737-113546759 TTTCACCCACTGAAAAATGTAGG - Intergenic
1090820141 11:130334712-130334734 TTTTAAAAACATAAATATGTGGG - Intergenic
1090826405 11:130389873-130389895 ATGTGCACACAGAAATATGTAGG + Intergenic
1091839048 12:3606059-3606081 ATTAACACCCAGAAATATGTTGG - Intergenic
1093293057 12:17352970-17352992 TATAACACACACAAATAAGGAGG + Intergenic
1093341222 12:17976371-17976393 AGTAACACACAAGAATATGTGGG - Intergenic
1093905197 12:24682980-24683002 TTTAAAATACAAAAACATGTAGG - Intergenic
1094126633 12:27030760-27030782 TTTCACCCACAGAAATCTTTAGG - Intronic
1095215822 12:39546187-39546209 TTTAATACACAAGAATATGAAGG + Intergenic
1096062680 12:48715418-48715440 CCTAACAAACAAAAATATGTGGG + Intronic
1097363491 12:58684711-58684733 TTAAACACATAGAAATTTGCAGG + Intronic
1097552586 12:61094074-61094096 GCTACCAAACAGAAATATGTAGG - Intergenic
1098623146 12:72630131-72630153 TTCAACCCACAGATGTATGTGGG - Intronic
1099653192 12:85456196-85456218 TTTCAGAAACAGAAATATTTAGG - Intergenic
1099749615 12:86756211-86756233 TTGAACACACAGAAAAAAGGTGG - Intronic
1099986467 12:89671267-89671289 TTTAACAGTCAGAAATGGGTTGG + Intronic
1104279755 12:127364987-127365009 TTTAAAAGACAGAAAAGTGTGGG + Intergenic
1104606436 12:130193024-130193046 TGTAACATACAGAGGTATGTCGG + Intergenic
1106816530 13:33414300-33414322 TTTATCACACAGAAAAACTTAGG + Intergenic
1107003203 13:35575629-35575651 TTTTTCACACTGAAATATTTAGG - Intronic
1107318603 13:39161345-39161367 TCAAAGACACAGAAATATATAGG + Intergenic
1108161760 13:47647524-47647546 TTTAAAACACAAAATAATGTTGG + Intergenic
1108442954 13:50474669-50474691 TATAACATACAAAATTATGTTGG - Intronic
1108582077 13:51836313-51836335 TATAACAAACAGAAACTTGTTGG - Intergenic
1109119175 13:58432293-58432315 TTTAACTCACTGAAATATAATGG - Intergenic
1109131154 13:58587401-58587423 TTGAAAACACAGAAAGATGGTGG + Intergenic
1109601707 13:64639489-64639511 TATAACAAACAGAAATGTATTGG - Intergenic
1110133259 13:72033644-72033666 TTTAACAAACAGGCATATATTGG - Intergenic
1110424904 13:75355931-75355953 TTAAACCCACAAAAGTATGTAGG + Intronic
1110850508 13:80239508-80239530 TTTGGCAAACAGAAATAGGTTGG + Intergenic
1110918922 13:81059695-81059717 TTTCACATAAAGAAAAATGTAGG - Intergenic
1111773934 13:92635332-92635354 TTTAAAAAACAGAAATTTATTGG + Intronic
1111885610 13:94017182-94017204 TTAACCACACAAAAATGTGTTGG - Intronic
1112179002 13:97058223-97058245 CTTAACACAGAGAAATATTCTGG - Intergenic
1112303320 13:98250420-98250442 TTTAACAAATAAAAATATGAGGG + Intronic
1112592615 13:100777355-100777377 ATTTACACACATAAATATATTGG - Intergenic
1112987983 13:105475816-105475838 TTTAAGACAAAGTAAGATGTTGG + Intronic
1113971695 13:114196167-114196189 TTTAAAAGACAGAATTAAGTGGG - Intergenic
1114213676 14:20638450-20638472 TTTAGTACTCAGAAATATTTTGG + Intergenic
1114241857 14:20875379-20875401 TTTGAGGCAGAGAAATATGTGGG - Intergenic
1114248446 14:20935944-20935966 TTTGAGGCAGAGAAATATGTGGG - Intergenic
1114916674 14:27276095-27276117 TTTAACTCAGAGAAATAAGGAGG - Intergenic
1115064481 14:29240526-29240548 TTTGAAACAAAAAAATATGTGGG - Intergenic
1115316955 14:32034874-32034896 TTTATCACTGAGTAATATGTAGG - Intergenic
1116232598 14:42236043-42236065 TTAAAGACACAGAAATATAGAGG - Intergenic
1116386417 14:44336028-44336050 TTTAAAAGATAGAAATAAGTGGG + Intergenic
1116731467 14:48628013-48628035 TTTAAAACAAAGAAATATAGGGG - Intergenic
1116974370 14:51099448-51099470 TATAAGAAACAGAAATATATTGG + Intergenic
1117659120 14:57985936-57985958 TTTTCCACACAGAACTTTGTGGG + Intergenic
1118072293 14:62258295-62258317 CTGAAGACACAGAAATAGGTGGG + Intergenic
1118792923 14:69112131-69112153 TTCAACCCACAGAGATATTTTGG - Intronic
1119552279 14:75523645-75523667 TTTAACCCACGGATACATGTCGG - Intronic
1120191929 14:81447417-81447439 TTTATTACACAGATATTTGTAGG + Intergenic
1120889813 14:89481876-89481898 TTTCACACCCAGAAATATCCTGG - Intronic
1121385760 14:93523050-93523072 TTAAACTCACAGGACTATGTTGG - Intronic
1123165533 14:106322253-106322275 ATTAACAGACAGAATTATGAAGG - Intergenic
1123817465 15:23994442-23994464 TTTAACACATGGGGATATGTGGG + Intergenic
1124151686 15:27185206-27185228 TTTAACATATCAAAATATGTGGG - Intronic
1125347924 15:38738268-38738290 ATTGACACCCATAAATATGTAGG - Intergenic
1125917307 15:43500499-43500521 TTTTAGACACAGAAGTATTTTGG - Intronic
1125995072 15:44151433-44151455 ATTAACACACAAAAATCAGTTGG + Intronic
1126664926 15:51067543-51067565 TTTAATACACAGACAGATTTGGG + Intronic
1127603719 15:60564703-60564725 TTTATCACTCAGATATATTTGGG + Intronic
1127781696 15:62321996-62322018 ATTAAAACACAGAAAGATGTAGG - Intergenic
1128003431 15:64215932-64215954 TTTAAAACACATAAATAGGCTGG + Intronic
1130834240 15:87633479-87633501 TATAACAAACAGAAATTTATTGG - Intergenic
1130853081 15:87817009-87817031 TTAAACACACAGCGATATGCAGG + Intergenic
1131187259 15:90285518-90285540 CTGAACCCACAGAAAGATGTGGG - Intronic
1131759672 15:95608010-95608032 CTAACCACACAGAAATATGTAGG + Intergenic
1131881126 15:96863285-96863307 TTGTATACACAGAACTATGTTGG - Intergenic
1131967859 15:97864434-97864456 CTTAACACCAAGAAGTATGTAGG + Intergenic
1133114914 16:3572710-3572732 TTTATCCTAAAGAAATATGTGGG + Intronic
1135831235 16:25775532-25775554 TTTCAGACACAGCAAGATGTGGG - Intronic
1138360163 16:56421884-56421906 TTTTACACTAACAAATATGTGGG - Intronic
1138930027 16:61642157-61642179 TTTAACACACTGAGATAATTAGG - Intergenic
1140463699 16:75162083-75162105 TTTAATACATAAAAATATTTCGG - Intronic
1142776719 17:2146020-2146042 TTCAACAAAGAGAAATATTTAGG - Intronic
1143972463 17:10805436-10805458 TTTTACACATAGAAAAATGAAGG - Intergenic
1144408111 17:14972469-14972491 TTTACCATACAGAAATGTGCAGG + Intergenic
1145300942 17:21636410-21636432 TTTATCATACAGTAATCTGTGGG + Intergenic
1146207338 17:30916132-30916154 TATTAAACACACAAATATGTTGG + Intronic
1146866697 17:36342386-36342408 TGTAACCCACAGAAGTATTTGGG - Intronic
1147069565 17:37942995-37943017 TGTAACCCACAGAAGTATTTGGG - Intergenic
1147081095 17:38022533-38022555 TGTAACCCACAGAAGTATTTGGG - Intronic
1147097037 17:38146490-38146512 TGTAACCCACAGAAGTATTTGGG - Intergenic
1148900856 17:50875923-50875945 TTTAACAGACGGGAAGATGTTGG + Intergenic
1149889844 17:60377996-60378018 TGTAACCCACAGAAATATTTGGG + Intronic
1150841561 17:68612067-68612089 TGTAACACAAATAAATATCTTGG + Intergenic
1154133255 18:11754098-11754120 TTTAACAAACACAAATATTTTGG - Intronic
1154237041 18:12615751-12615773 CTTAAAACACAGAAATAATTTGG - Intronic
1155117936 18:22788057-22788079 TTTAACACAAAGAGAACTGTAGG + Intergenic
1155243786 18:23887997-23888019 TTTAAATCACAGAAATATTCAGG - Intronic
1155456227 18:26017223-26017245 TATAACACAAAGAGATATTTAGG - Exonic
1155994356 18:32314001-32314023 TATACCACATAGAAATATGTAGG + Intronic
1156703512 18:39852822-39852844 TCTAGCAAACAGAAATATTTGGG - Intergenic
1156789770 18:40956609-40956631 TTTGGCACAGAGAAATAGGTTGG + Intergenic
1156906529 18:42359264-42359286 TTTAAAAAACATAAATATCTGGG + Intergenic
1157850121 18:51040994-51041016 TTTAACCAACTGAAATATGAAGG - Intronic
1159297113 18:66506803-66506825 TATCACAAAGAGAAATATGTTGG + Intronic
1159549765 18:69882585-69882607 TATAAGACTCAGAAATATTTGGG - Intronic
1159654822 18:71020358-71020380 TATAATAAACAGAAATTTGTTGG - Intergenic
1160412436 18:78684010-78684032 TTAAACACATGGAAATATGAAGG + Intergenic
1161782805 19:6304693-6304715 TTCAACACACATACATATATTGG - Intergenic
925335503 2:3096105-3096127 TTCAATAGACTGAAATATGTGGG - Intergenic
926897328 2:17707790-17707812 ATTAACATACTGAAATATGTAGG + Intronic
927144141 2:20150213-20150235 TTTAAAATAAAGAAATAAGTAGG - Intergenic
928515545 2:32041457-32041479 TTAAAAACACAAAAATATGCTGG - Intergenic
928738361 2:34319637-34319659 TTTAAAACACAAATATATATAGG + Intergenic
929033383 2:37669907-37669929 TTAGACACTCAGAAATAAGTTGG - Intronic
930299945 2:49602897-49602919 TTTAATGCACATAAAAATGTTGG + Intergenic
931638371 2:64360592-64360614 GTTTACACACAGAAAAATCTGGG - Intergenic
932199099 2:69810056-69810078 TTTAAGAAACAGGAATATCTTGG + Intronic
932832202 2:75001005-75001027 TTTATCGCACAGAATTTTGTGGG - Intergenic
933106019 2:78326470-78326492 TTCCAAACACACAAATATGTGGG + Intergenic
936391367 2:112077567-112077589 TTTAACATGTAGAAATGTGTAGG + Intronic
936441326 2:112556135-112556157 TTTATGACACAGGAAGATGTAGG + Intronic
936558612 2:113517314-113517336 TTTAAACCACAGAAATTTGGAGG - Intergenic
937042301 2:118832227-118832249 TTGAACACACAGCACTAAGTTGG - Intergenic
937154158 2:119706845-119706867 TGTTTCACACAGAAAGATGTGGG + Intergenic
937491820 2:122377420-122377442 TCTAAGACACAGAAATTTGAAGG - Intergenic
937682083 2:124654795-124654817 CTAAACATACACAAATATGTGGG + Intronic
937683962 2:124675328-124675350 ATTCAAACACACAAATATGTTGG - Intronic
938209540 2:129456013-129456035 TTTAACACGGAAAAATATTTGGG + Intergenic
938810683 2:134850028-134850050 TTTTACACACATAATTCTGTCGG + Intronic
939894277 2:147772947-147772969 TTTCACACACAGCAATATGAAGG + Intergenic
940932865 2:159456101-159456123 TTTAATACAAAGAAATTTGAGGG + Intronic
941146663 2:161855494-161855516 TTCAATATACAGAAAAATGTTGG + Intronic
942167579 2:173256835-173256857 TCTAGCACACTGAAATATTTAGG - Intronic
942477831 2:176347459-176347481 TAAAACACACAGAAATATTGTGG - Intergenic
942844908 2:180412623-180412645 ATAAAAAGACAGAAATATGTTGG + Intergenic
944620621 2:201511464-201511486 TTTTACAGGCAGAAATATTTAGG - Intronic
944980072 2:205107226-205107248 TTTATCCAACAGTAATATGTGGG - Intronic
945178710 2:207069574-207069596 TTTAACAAATAGACATGTGTTGG + Intergenic
945290513 2:208122561-208122583 TTTAAAATACAGAAATATAAGGG + Intronic
945393354 2:209291850-209291872 TTTAAAACACAAAAATATTGAGG - Intergenic
947031331 2:225799281-225799303 TTAAACAGACAGAATTATATAGG - Intergenic
947049200 2:226023254-226023276 TTAAAAAGACATAAATATGTTGG + Intergenic
947097074 2:226578354-226578376 TTCCACACACAGAAATATTTGGG + Intergenic
947372174 2:229458322-229458344 TTTAACAATCCCAAATATGTAGG + Intronic
948022483 2:234747230-234747252 TCCAACAAACAGAAATTTGTTGG - Intergenic
948740836 2:240044785-240044807 TTTAACACACCGCAATTTATTGG + Intergenic
1169926798 20:10792483-10792505 TTTAAAACATAAAAATGTGTGGG + Intergenic
1170477663 20:16731914-16731936 TTTAAAAAACAAAAATAGGTAGG + Intronic
1170777820 20:19393071-19393093 TTTAACAAACAATAATTTGTTGG - Intronic
1173034093 20:39391734-39391756 TGTCACACACAGCAATCTGTAGG + Intergenic
1175435012 20:58940036-58940058 TCTACCACACAGAAATTTGAAGG - Intergenic
1177334249 21:19702820-19702842 TTTAAGACAGACAAATATATGGG - Intergenic
1177361076 21:20072169-20072191 TTGAACACACAGTAACATATAGG - Intergenic
1177386463 21:20415519-20415541 TTTTAAACACAAACATATGTTGG + Intergenic
1177394652 21:20517184-20517206 TTTAACAGTCAGCAATATGCTGG + Intergenic
1177415140 21:20783163-20783185 TTTAAAACAAAAAAATATATAGG + Intergenic
1178105125 21:29309831-29309853 TTAAACACACAGAATTATTAGGG - Intronic
1178165772 21:29974966-29974988 TTTAAAAGCCAGAAATATTTTGG + Intergenic
1182756735 22:32686440-32686462 TTTACCACACTGATATGTGTGGG + Intronic
1182914881 22:34020355-34020377 TCTTACACACAGAGATAAGTTGG + Intergenic
1185200094 22:49496714-49496736 TTTAACACACTTATATTTGTTGG - Intronic
949164757 3:925847-925869 CTTAACACTGAGAAATATCTAGG - Intergenic
949367540 3:3299405-3299427 GTAAACACTCAGAAATATGATGG - Intergenic
949381672 3:3453886-3453908 TGTAAAATACAGTAATATGTTGG + Intergenic
950878193 3:16297909-16297931 TTTAACACACATATAGATCTGGG - Intronic
951087644 3:18532716-18532738 TTTAACACACACAAAACTGCTGG - Intergenic
951659095 3:25042417-25042439 TTTAACACCCAGTAATGTTTTGG + Intergenic
951972550 3:28463680-28463702 TTGAACATACAGAAATTTTTTGG + Intronic
952362431 3:32644265-32644287 TTTAACATCTAGAAATATATGGG - Intergenic
952657010 3:35799045-35799067 TTGAACACACAGAGATAGGATGG + Intergenic
953641274 3:44710764-44710786 TTTGACAGACAGACATTTGTCGG + Intergenic
953720206 3:45348421-45348443 CTTTACACACAGAAACCTGTAGG + Intergenic
954694747 3:52416487-52416509 CTTAACAAACGAAAATATGTGGG - Intronic
954961373 3:54568049-54568071 ATTGCCACACAGAATTATGTTGG + Intronic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
955443184 3:58978749-58978771 ATTAAAACAAAGAAATATGAGGG + Intronic
955568388 3:60274972-60274994 TTTAAAAAACAGATAAATGTGGG - Intronic
956479421 3:69659210-69659232 TTTAACACACTTAAATAAGTGGG + Intergenic
957321029 3:78630297-78630319 TTTAAAACACATAAATATTGTGG + Intronic
957628940 3:82693528-82693550 TTTCAAACACAGAAAAATGATGG + Intergenic
957832663 3:85543646-85543668 TATAACAAACAGAAATTTATAGG + Intronic
958089617 3:88859385-88859407 TATAACAGACAAAAATATGACGG - Intergenic
958708334 3:97685794-97685816 TTTAACACATGGTAATATATAGG + Intronic
959029036 3:101276175-101276197 TCTAACACAGAGAAGTTTGTGGG + Intronic
960882257 3:122356701-122356723 TTTATCCCACAGAATTACGTTGG - Intergenic
961051577 3:123751488-123751510 TGTAACTCAGAAAAATATGTAGG - Intronic
963421211 3:145062810-145062832 TTTAACATGTATAAATATGTAGG + Intergenic
963433812 3:145242614-145242636 TTTAGAAGACAGAAAGATGTGGG - Intergenic
964037403 3:152216213-152216235 TTTAACACATATAATTTTGTTGG + Intergenic
964169532 3:153753311-153753333 TTAAACATACAGAAATCAGTAGG + Intergenic
965192279 3:165547195-165547217 ATTAACACAGATAATTATGTTGG - Intergenic
965457843 3:168926172-168926194 TTAAAGACACAGAAAATTGTTGG - Intergenic
967382236 3:188872031-188872053 TTTAACACAATAAAAAATGTAGG + Intronic
967623034 3:191657805-191657827 TTTAACACATAAACATCTGTTGG - Intergenic
968531638 4:1094968-1094990 TTCAACCCACAGAAATATTTTGG + Intronic
971355554 4:25891731-25891753 TTTAACACATACATATATGCAGG + Intronic
971939998 4:33201680-33201702 TTTAACAGACACAAATGGGTAGG + Intergenic
972094278 4:35328941-35328963 TTTGGCACACAGAAATACGTAGG - Intergenic
972098645 4:35382758-35382780 TATAATAAACAGAAGTATGTTGG - Intergenic
972202724 4:36734572-36734594 TTGTACACATAAAAATATGTGGG + Intergenic
973998316 4:56482622-56482644 TTCAAAATACAGAAATATCTTGG - Intronic
974364537 4:60929202-60929224 TTTAAAACACAGAAATTGGCTGG + Intergenic
974532272 4:63124283-63124305 TTTATCCCACAGAGATATATTGG - Intergenic
974679559 4:65143740-65143762 TTTAAGAAACAAAAATAAGTTGG + Intergenic
974783250 4:66582819-66582841 TTTAACATTCAGAAATAAGTAGG - Intergenic
975033552 4:69654737-69654759 TTTTACACCTAGAAATATATTGG - Intergenic
975598551 4:76074960-76074982 TTTAACACAAAGTAGCATGTTGG + Intronic
975890001 4:79016451-79016473 TTTAACTTAGAGAAAGATGTGGG + Intergenic
975952925 4:79796163-79796185 TTGGAGATACAGAAATATGTAGG - Intergenic
976339460 4:83930482-83930504 TCTCACACACAGAAACCTGTAGG + Intergenic
976482712 4:85563408-85563430 GTGAGCACACAGCAATATGTTGG - Intronic
976675033 4:87693801-87693823 TTTAAAACACAGGAAATTGTTGG + Intergenic
977481767 4:97587349-97587371 TATAACACAAAGAAACCTGTTGG - Intronic
977990042 4:103430542-103430564 TACAAAACACAGAAATATATTGG + Intergenic
978303010 4:107292452-107292474 TTTGCCACACAGAGATATGAGGG + Intergenic
978386632 4:108182210-108182232 TTAAACACAATGAAATGTGTAGG + Intergenic
978486542 4:109260928-109260950 TTTTACATACAGAAATAAATTGG - Intronic
979002179 4:115236487-115236509 TTTAACATAGCCAAATATGTAGG - Intergenic
979095832 4:116549712-116549734 TTTAACAAATATAAATATATAGG - Intergenic
980085123 4:128382955-128382977 TGTAACACACATAAGTATATAGG - Intergenic
980429909 4:132680792-132680814 TTTTACACACCAAAATATGGAGG - Intergenic
982963799 4:161876418-161876440 TGTAACATACTTAAATATGTTGG + Intronic
983497155 4:168455867-168455889 TTTAATACACATAAATTGGTGGG + Intronic
984198074 4:176684102-176684124 TTAAAAACACAGAAATACCTTGG - Intronic
984552535 4:181177953-181177975 TACAACACACAAAAATGTGTTGG - Intergenic
986741425 5:10709123-10709145 TTAAATACAAAGAAATATGGTGG - Intronic
987079522 5:14414057-14414079 TTTAACCCAAAGAAACCTGTTGG - Intronic
987795345 5:22620842-22620864 TTTATCACCTAGAAATATTTTGG - Intronic
987827003 5:23044909-23044931 TCTAACACACTGCATTATGTAGG - Intergenic
988007332 5:25433565-25433587 ATTAACACAGACATATATGTAGG - Intergenic
988255932 5:28820070-28820092 TTTAACACATAGAAATCAGTGGG - Intergenic
989233261 5:39112790-39112812 TTGAACACACAGATATAGGAGGG - Intronic
989321065 5:40134396-40134418 TTTCAAAAAAAGAAATATGTTGG + Intergenic
989658335 5:43769806-43769828 TTCAACACAGAGAACTACGTAGG - Intergenic
989731290 5:44653090-44653112 TTTAACACAAAGAAACAAGTTGG + Intergenic
991362558 5:65836086-65836108 TTTAACATACTGACATATTTGGG - Intronic
991443115 5:66672161-66672183 ATTTAAACACAGACATATGTAGG + Intronic
992059037 5:73023738-73023760 TTTAACACACAGAAATATGTTGG + Intronic
993530887 5:89024017-89024039 ATTAACACATAGAAAAATATAGG + Intergenic
993622725 5:90187577-90187599 CCCAAGACACAGAAATATGTGGG + Intergenic
993921117 5:93803775-93803797 ATCAACACATAGAAATATTTTGG - Intronic
994747569 5:103697698-103697720 GGTAAAACACACAAATATGTGGG - Intergenic
995701551 5:114940580-114940602 TTTATCAAACAGAACTCTGTAGG + Intergenic
996072162 5:119143829-119143851 TAAAAAAAACAGAAATATGTTGG + Exonic
996165667 5:120219932-120219954 TTTAAAAATCAGAGATATGTTGG - Intergenic
996209341 5:120786187-120786209 ATTAAGAAACAGAAATATTTGGG - Intergenic
997707544 5:135972118-135972140 TTTAATTCCCAGGAATATGTAGG + Intergenic
1000256728 5:159546091-159546113 TTTAAAACAGAGGAATATATTGG + Intergenic
1000724089 5:164746763-164746785 TTTAAAACACAGGATAATGTGGG - Intergenic
1000913991 5:167057863-167057885 GTTAAAACTCACAAATATGTTGG + Intergenic
1002365584 5:178707155-178707177 TCTAGCACTCAGAAATTTGTTGG - Intergenic
1003375183 6:5570128-5570150 CTTAACAGACAGAAACATTTGGG - Intronic
1003570529 6:7253640-7253662 TTTAACACACATTTATATGTGGG + Intergenic
1003753055 6:9083871-9083893 TCTCACACACACAAAAATGTTGG - Intergenic
1003951250 6:11117895-11117917 TTGAAAACACAAAAATTTGTTGG - Intronic
1003988769 6:11464917-11464939 CTCAAAAAACAGAAATATGTTGG + Intergenic
1005842320 6:29751907-29751929 TTTCACTCACAGAAATGTGTAGG - Intergenic
1006825034 6:36928563-36928585 TTTTACCCTCAGAAAAATGTTGG + Intronic
1008069087 6:47081061-47081083 TTCAACACACAAATATTTGTGGG + Intergenic
1008424634 6:51342912-51342934 TTTAACACAGGGAACAATGTAGG - Intergenic
1008755053 6:54785227-54785249 TTGAACCCACAGAACTATCTGGG - Intergenic
1008974796 6:57411928-57411950 TTTAAAATAGAGAAAAATGTTGG - Intronic
1009163682 6:60313434-60313456 TTTAAAATAGAGAAAAATGTTGG - Intergenic
1010792967 6:80086198-80086220 ATTAGCTCACAGAAATATGCAGG + Intergenic
1010793037 6:80086998-80087020 ATTAGCTCACAGAAATAAGTTGG + Intergenic
1010850860 6:80774501-80774523 TTTAACATACTTACATATGTAGG + Intergenic
1010883231 6:81205338-81205360 CTTAACTCCCAGAAATATATAGG - Intergenic
1010908023 6:81517012-81517034 TTTAACATACAGACATCTGATGG + Intronic
1011305134 6:85917276-85917298 TTTAACCCACAGAGATTTTTTGG + Intergenic
1012148398 6:95715657-95715679 TTTAAAACACAGATCCATGTAGG - Intergenic
1012496487 6:99839025-99839047 TTTAACTTAAAGAAATATGTTGG + Intergenic
1013987431 6:116212045-116212067 TATAACAAACATAAATATATAGG - Intronic
1014692143 6:124575045-124575067 ATTTAAACACAGAAATATTTTGG - Intronic
1014748079 6:125223293-125223315 GTAAGCACACAAAAATATGTTGG - Intronic
1014817967 6:125955835-125955857 TTTAACACCAAAAAATTTGTTGG - Intergenic
1014987368 6:128028159-128028181 ATTAAAACACATAAAAATGTGGG + Intronic
1015288714 6:131512861-131512883 ATTAATAGACAGAAATATCTAGG - Intergenic
1015563474 6:134541242-134541264 GTAGACACACAGATATATGTAGG - Intergenic
1015642327 6:135348840-135348862 TCTAACACACAGTAATCTCTCGG - Intronic
1015989129 6:138917214-138917236 TTTAAAACACAGAATTCTTTTGG + Intronic
1016345452 6:143108634-143108656 TTCAACAGACACATATATGTGGG + Intronic
1017232483 6:152088355-152088377 TTTATCATACACAAATAGGTTGG - Intronic
1017858730 6:158375774-158375796 TATATAATACAGAAATATGTAGG + Intronic
1018255617 6:161915636-161915658 TTTGACACACAGCATGATGTAGG - Intronic
1019232231 6:170577063-170577085 TTTAAAACACAAAAATACTTAGG - Exonic
1019455686 7:1125952-1125974 TTTAACACTCAGAACTTGGTGGG + Intronic
1020457166 7:8387127-8387149 TTTAACACCCAAAAATCAGTCGG - Intergenic
1020950201 7:14666220-14666242 TTTAACAAAAAAAGATATGTTGG - Intronic
1021038792 7:15835276-15835298 TTTAACAAAGAGAAATCTATTGG - Intergenic
1021118080 7:16766233-16766255 ATGAACACCCAAAAATATGTTGG - Intronic
1021440853 7:20673444-20673466 TATTACACACATAAATATTTAGG + Intronic
1023389028 7:39689581-39689603 ATTTACACACAGACATTTGTGGG - Intronic
1023967204 7:44969262-44969284 TTTAAGACACTGAAACATGCCGG - Intronic
1024142535 7:46476907-46476929 TCTCAAACACAGAAATAGGTTGG + Intergenic
1024700023 7:51896770-51896792 TTAAAAACACAGAAACATTTTGG + Intergenic
1025224600 7:57146028-57146050 TTTAAAACTCACAAATATGTGGG - Intergenic
1026434962 7:70388128-70388150 TTCAACACATAGAATCATGTTGG - Intronic
1027839878 7:83296102-83296124 TTTAAAAGATAGAAGTATGTTGG - Intergenic
1027953146 7:84845764-84845786 TTTACCCCACAGAAATATGGTGG + Intergenic
1028267797 7:88749335-88749357 TTTAAAACACTGAACTATTTTGG + Intergenic
1028302495 7:89218054-89218076 TTTAACTTAAAGAAATATGACGG - Intronic
1028974139 7:96893261-96893283 TTTGAGACAAAGAAAGATGTAGG - Intergenic
1028981858 7:96975952-96975974 TGTAACACACTGGAATATGAAGG - Intergenic
1029955433 7:104633994-104634016 TTTAAATCACTGAAATACGTAGG - Intronic
1031092996 7:117385174-117385196 TGTAACACACAGCAAAATCTGGG - Intronic
1031150566 7:118049243-118049265 TTTATCACACAGCAATAAATAGG + Intergenic
1031209121 7:118799962-118799984 TTTAATATACAGAAATATCCAGG - Intergenic
1031292538 7:119955106-119955128 TTTAATACACATAAGCATGTGGG - Intergenic
1031448125 7:121880109-121880131 TTTACCACACTGGAATATTTAGG - Intronic
1032892839 7:136217886-136217908 TTTCATACAAAGAAATATTTCGG - Intergenic
1033093324 7:138406792-138406814 TATAATACACAGAAATTTATTGG - Intergenic
1033160813 7:138994919-138994941 TTTAACTCACAGAATTAATTTGG + Intergenic
1033182145 7:139190763-139190785 TATAAAACATAGAAAGATGTGGG - Exonic
1033900870 7:146137473-146137495 TGCAACACAAAGAAATATTTAGG + Intronic
1035983020 8:4394167-4394189 TACAACACACAGATGTATGTTGG - Intronic
1035996349 8:4551624-4551646 TTTAACATACAGGACAATGTTGG + Intronic
1036964648 8:13283120-13283142 GTTAACATAGAGAAATATTTGGG - Intronic
1037250859 8:16892231-16892253 TTTATCACAAAGAAATCTCTAGG - Intergenic
1040834112 8:51713931-51713953 TTTTGCAAACATAAATATGTAGG - Intronic
1041121482 8:54590694-54590716 TTTAAACCACATAAATATGGTGG - Intergenic
1041411155 8:57557220-57557242 TTTAAAACACTGAAAGATGGAGG - Intergenic
1042338810 8:67657405-67657427 TTTATAACACAGATATTTGTTGG - Intronic
1042339019 8:67659412-67659434 TTTAACTCAAATAAATAGGTTGG - Intronic
1043225307 8:77720056-77720078 TTTATCACACAAATATATTTTGG + Intergenic
1043394149 8:79820372-79820394 TTTATGACACTGAAATATATAGG + Intergenic
1043578218 8:81682214-81682236 TTTAGAACACAAATATATGTTGG - Intronic
1044336779 8:90993619-90993641 TTTATCATACAGAAGTATTTTGG + Intergenic
1044657805 8:94566384-94566406 TATAACAAACAGAAATTTATTGG - Intergenic
1045017920 8:98014941-98014963 GTTAACTTTCAGAAATATGTAGG + Intronic
1045321955 8:101088671-101088693 TTTGAAACACACAAAGATGTGGG + Intergenic
1045517216 8:102870426-102870448 TATAATGCACAGAAATTTGTTGG - Intronic
1045981279 8:108191205-108191227 TTTGATACAAAGAAAAATGTTGG + Intergenic
1046319557 8:112554615-112554637 TTTATAACAAAGAAATATGGGGG - Intronic
1046543684 8:115619725-115619747 GGTGACAGACAGAAATATGTTGG - Exonic
1047525184 8:125626923-125626945 TTTAATAAACAGTAATATGTGGG + Intergenic
1047557073 8:125943777-125943799 ATTAACACACCCAAATATATAGG - Intergenic
1047850274 8:128849635-128849657 TTTTACACATATAAATATGCTGG - Intergenic
1049350393 8:142161192-142161214 TCTAACACAGAGCAATATGCTGG + Intergenic
1050129260 9:2393168-2393190 TTTAATATACAGAAATATAGAGG - Intergenic
1050135592 9:2460057-2460079 TTAAACAAACAGATAAATGTGGG - Intergenic
1050736488 9:8769033-8769055 GCTAACACACAGAATTAGGTGGG - Intronic
1051129181 9:13840732-13840754 TTTAAGAAACAGAAATAAGCAGG + Intergenic
1051685017 9:19649338-19649360 CGTTACACACAAAAATATGTTGG + Intronic
1052454030 9:28671084-28671106 TTTCCCATACACAAATATGTAGG + Intergenic
1053735461 9:41098946-41098968 TTTAAACCACAGAAATTTGGAGG + Intergenic
1054692916 9:68332455-68332477 TTTAAACCACAGAAATTTGGAGG - Intronic
1055317986 9:75053488-75053510 TTTAATATACAGAATTATATAGG + Intergenic
1055430754 9:76241096-76241118 TGTAAAACACAGAAGTTTGTGGG + Intronic
1055743802 9:79420078-79420100 TTTAACAAAAAGAACTAAGTTGG - Intergenic
1056350756 9:85746320-85746342 TTTAGGACACAGACACATGTGGG - Intergenic
1056449587 9:86703322-86703344 TTAAACCAACAGAAATATGTTGG + Intergenic
1057368664 9:94449062-94449084 TTTAACACAGAAAATAATGTAGG + Intronic
1057613810 9:96570272-96570294 CATAAAACATAGAAATATGTAGG + Intronic
1058197158 9:101991779-101991801 TTTATCACACAGATATAGGAAGG + Intergenic
1059659965 9:116390959-116390981 CCTACCACACAGAAGTATGTTGG - Intronic
1060533789 9:124366549-124366571 ATTTACACACAGAAAAATTTCGG - Intronic
1186596874 X:10991431-10991453 TGTAACTCACAGAAGTATTTTGG + Intergenic
1188405047 X:29797480-29797502 TTTAACAAACAGAAGGATGAGGG - Intronic
1188732024 X:33660444-33660466 GTTAACAAAAAGAAAAATGTGGG + Intergenic
1189184368 X:39040364-39040386 ATTAAAACATACAAATATGTAGG - Intergenic
1189770708 X:44423649-44423671 TTTCACACACAAAAATTTCTTGG - Intergenic
1190550472 X:51574708-51574730 TGATCCACACAGAAATATGTTGG - Intergenic
1191896000 X:65994107-65994129 TTGAACACACAGCCATCTGTAGG + Intergenic
1193238267 X:79135478-79135500 TTTACCAAACAAAAATGTGTAGG - Intergenic
1193258255 X:79375968-79375990 TAGAACATACAGAAATATGAAGG + Intergenic
1194118692 X:89934623-89934645 CTGATCTCACAGAAATATGTGGG - Intergenic
1194682892 X:96875736-96875758 TTAACCACACAAAAAAATGTAGG - Intronic
1196087591 X:111701956-111701978 TGAAAAACACACAAATATGTGGG - Intronic
1197349153 X:125360698-125360720 TATAACAAACAGAAATTTATTGG - Intergenic
1197399019 X:125965924-125965946 TTTAACACCCACATATAAGTTGG + Intergenic
1197850619 X:130855295-130855317 TTCAAAAAAGAGAAATATGTAGG + Intronic
1198411097 X:136369160-136369182 GTTAACACACAGAACCATGAAGG + Intronic
1198619519 X:138490609-138490631 TTAAACTAACAGGAATATGTGGG + Intergenic
1200471565 Y:3592189-3592211 CTGATCTCACAGAAATATGTGGG - Intergenic