ID: 992061955

View in Genome Browser
Species Human (GRCh38)
Location 5:73060543-73060565
Sequence TGGGGGACAAAGTTTAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992061955_992061962 23 Left 992061955 5:73060543-73060565 CCAGTCTTAAACTTTGTCCCCCA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 992061962 5:73060589-73060611 CATCTTAACATCCTCTACCCAGG 0: 1
1: 0
2: 1
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992061955 Original CRISPR TGGGGGACAAAGTTTAAGAC TGG (reversed) Intronic
901216178 1:7556614-7556636 TGGGGCACAAGGTTTGAGATGGG - Intronic
902974917 1:20081553-20081575 CAGGGGACACAGTTTAGGACCGG + Intronic
904287304 1:29460872-29460894 AGGGGGACAAGGTCCAAGACAGG + Intergenic
905246443 1:36617805-36617827 TGGGGGGCAAAGGTTAAGAAGGG + Intergenic
907350146 1:53822608-53822630 AGTGGGACAAAGATTGAGACTGG + Intronic
907807638 1:57837512-57837534 TGGGGGAGATATTTTAGGACAGG - Intronic
908278097 1:62498045-62498067 TGAGGCCCAAAGTTTGAGACCGG + Intronic
908740206 1:67319643-67319665 TGTGGGACTAAGTCTCAGACAGG + Intronic
911027742 1:93452640-93452662 TGGAGCACAGAGTTCAAGACTGG - Intronic
911097858 1:94069956-94069978 TGGAGGACAAAGATTCACACTGG + Intronic
913277570 1:117154019-117154041 TGTGGGAAAATGTTTAAGCCTGG + Intronic
916937908 1:169649100-169649122 TGGGGATCAAATTTTAACACAGG + Intergenic
921834658 1:219765372-219765394 TGGGTGACACATTTGAAGACAGG - Intronic
922860682 1:228813183-228813205 ATGGGGACAAAGTTTCTGACTGG + Intergenic
923983911 1:239357832-239357854 AAGGGCACAGAGTTTAAGACAGG - Intergenic
1064928433 10:20596028-20596050 TTTGAGAAAAAGTTTAAGACGGG + Intergenic
1067233317 10:44426777-44426799 TGAGTGACCAAGTTGAAGACAGG - Intergenic
1068671125 10:59724601-59724623 TGGGGGGCAAGGTTTGAGAGAGG - Intronic
1069915623 10:71784981-71785003 TGGGCGACAAAGCTGGAGACAGG - Intronic
1073603159 10:104866619-104866641 GTGGGGACAAAGTTTACCACAGG + Intronic
1079275414 11:19031441-19031463 TGGGGGACAAATATTAAAAAAGG + Intergenic
1081262463 11:40977664-40977686 TAGGGGACAGAGTTTAAAACAGG - Intronic
1081741741 11:45445744-45445766 TTGGGGACCAAGTTTATCACTGG + Intergenic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1084153497 11:67302014-67302036 TGGAGGACAAAGGCAAAGACAGG - Intronic
1085031974 11:73277326-73277348 TGGGAGGCAGAGTTTGAGACTGG - Intronic
1086160815 11:83719875-83719897 TCGGGAACAAAGGCTAAGACTGG - Intronic
1086337469 11:85813138-85813160 TGGGGGAGAAATTTTAAGGCAGG + Intergenic
1087625546 11:100591978-100592000 TGTGGGACTAAGTTTCTGACAGG - Intergenic
1088992265 11:114963815-114963837 AGGGGGACAAAGCTGAAGGCAGG + Intergenic
1090283366 11:125477717-125477739 TGGGGTAAACAGTTTAGGACTGG - Intronic
1093149091 12:15600908-15600930 TGGGGGAAAAGGTTTAGGGCTGG - Intergenic
1095311204 12:40699060-40699082 AGGGAGTCAAAATTTAAGACTGG - Intronic
1102188428 12:110967282-110967304 TGGGGGACCAAAATTAAGATAGG + Intergenic
1107878232 13:44809330-44809352 TGAGGGAGAAATCTTAAGACTGG - Intergenic
1110419847 13:75294313-75294335 TGGGGGACAGTCTCTAAGACTGG - Intronic
1112947325 13:104946036-104946058 TTGGGAACAAAATTTAAGATGGG + Intergenic
1113893330 13:113748077-113748099 TGGGGGCCCAAGTCTAAAACGGG + Intergenic
1123090329 14:105739445-105739467 TGGGGGACAGTGTTGAGGACAGG + Intergenic
1134127386 16:11625610-11625632 GGGGGAACCAAGTCTAAGACAGG + Intronic
1139303627 16:65965021-65965043 TGGGGGAGAAAGGTGAAGAAGGG + Intergenic
1140672144 16:77289792-77289814 TGGAGGACATAGTTCAAAACTGG + Intronic
1141420531 16:83912449-83912471 TGAGGGACACAGATGAAGACAGG + Intronic
1146247626 17:31303608-31303630 GGGGGCACAAATTTTAAAACTGG - Intronic
1150186284 17:63184998-63185020 TTGGGGACAGAGTGTGAGACAGG + Intronic
1151365678 17:73614676-73614698 AGGGGGACAAAGTTTGAAAAGGG + Intronic
1152400647 17:80064593-80064615 TGGGGCACAGAGGTTAAGGCTGG - Intronic
1203159275 17_GL000205v2_random:34224-34246 TGAGGGACAAACATTCAGACCGG + Intergenic
1160139535 18:76309282-76309304 TAGGGGATACAGTTCAAGACAGG + Intergenic
1160577855 18:79867246-79867268 TGGGGCAGGAAGTCTAAGACAGG - Intronic
1167151676 19:47713684-47713706 TGGGGGACATGGTTACAGACTGG - Intronic
931785126 2:65611405-65611427 TGGGGGACCCATTTTAAGATGGG + Intergenic
937866899 2:126759296-126759318 TGGGGCCCAGAGTTCAAGACAGG + Intergenic
938073918 2:128322193-128322215 TTGGGGACAAACTTTTAGAGGGG + Intergenic
941579571 2:167277904-167277926 TGTGGGACGAGGATTAAGACTGG + Intergenic
941625601 2:167827262-167827284 TGGGGTACAAAGAACAAGACAGG + Intergenic
945670283 2:212794088-212794110 TGGGGGAGAAACTTTAAGCAGGG - Intergenic
946749332 2:222877644-222877666 TGGTGGACATAGTGTAAAACTGG + Intronic
947172972 2:227330600-227330622 TGGGAGAAAAATTTAAAGACAGG - Intronic
948997300 2:241588851-241588873 TAGGTGAAAAATTTTAAGACAGG + Intronic
1168954334 20:1824369-1824391 TGGAGGACACAGTTTCAGAAGGG + Intergenic
1171011238 20:21510500-21510522 TGGGGGTCTGAGGTTAAGACTGG - Intergenic
1173026371 20:39310993-39311015 TGAGAGACAAAATATAAGACAGG - Intergenic
1176336860 21:5607047-5607069 TGGTGGTCAAAGTTAGAGACTGG - Intergenic
1176390897 21:6213901-6213923 TGGTGGTCAAAGTTAGAGACTGG + Intergenic
1176470522 21:7102273-7102295 TGGTGGTCAAAGTTAGAGACTGG - Intergenic
1176494083 21:7484051-7484073 TGGTGGTCAAAGTTAGAGACTGG - Intergenic
1176506559 21:7654332-7654354 TGGTGGTCAAAGTTAGAGACTGG + Intergenic
1177086541 21:16712113-16712135 TTGGGGACAAAGTTCATAACAGG - Intergenic
1180523186 22:16229352-16229374 TGAGGGACAAACATTCAGACCGG + Intergenic
1181659185 22:24329372-24329394 TTGGGGAAAAAGTGTAAGAAAGG + Intronic
1181977005 22:26737383-26737405 TGAGGGATAAAGTTTAGGAAAGG - Intergenic
1185051984 22:48558936-48558958 TGGGGGACACAGTTCAGGCCTGG - Intronic
950717460 3:14859712-14859734 AGGGGTACAAAGTTTCAAACAGG - Intronic
952035625 3:29196897-29196919 GAAGGGACAAAGTTTACGACAGG - Intergenic
955129004 3:56145054-56145076 TGGGGGAAGAATTTTCAGACGGG - Intronic
957880729 3:86209144-86209166 TAGGGGAGAAATTATAAGACAGG - Intergenic
964634113 3:158842125-158842147 TGGGGGACAAAGTTGAATGCCGG - Intergenic
964708419 3:159645961-159645983 TGGAGGACCCAATTTAAGACAGG - Intronic
972543392 4:40057620-40057642 TGAGGGACAAAGTTGCAGATGGG - Intronic
972547659 4:40095945-40095967 AGGGGGACAAAGTTGCAAACAGG + Intronic
973153860 4:46923598-46923620 TAGAAGGCAAAGTTTAAGACAGG + Exonic
974246743 4:59329871-59329893 TGGGGGAAAAAGTCTAATATGGG + Intergenic
975747747 4:77491580-77491602 TAGGGTACAAAGTTTAAGGAAGG - Intergenic
975952056 4:79785855-79785877 TGGGAGACAAAGATGAAGACTGG + Intergenic
977386408 4:96345332-96345354 TGGGGTTCAATGTTTAAGAGGGG - Intergenic
977584581 4:98760675-98760697 GGGGGGATAAAGTTGAAGCCAGG - Intergenic
978574599 4:110176680-110176702 TGAGAGACAAAGTGCAAGACTGG + Intronic
984750639 4:183270026-183270048 TGATGAACAAAGTTTAAGAGGGG + Intronic
984960332 4:185091234-185091256 TGGGGGACAAAGATTAGGTCTGG - Intergenic
985606903 5:862706-862728 GGGGCTGCAAAGTTTAAGACGGG + Intronic
991015104 5:61923656-61923678 AGGGGGTCAAAGTTTTAAACAGG - Intergenic
992061955 5:73060543-73060565 TGGGGGACAAAGTTTAAGACTGG - Intronic
993072529 5:83183377-83183399 TAGGAGACAAAATGTAAGACGGG - Intronic
994275485 5:97832142-97832164 GGGGGGACAATGTTTAAGCTTGG + Intergenic
994503444 5:100609188-100609210 TTGGGTACTAAGTTTAATACCGG - Intergenic
995405201 5:111786970-111786992 TGCTGGACATAGTTTAAGAAGGG - Intronic
995438876 5:112167704-112167726 TTGGGGAGAAAGTCAAAGACGGG - Intronic
998113017 5:139516620-139516642 TGGGGGACAAAGAAGCAGACAGG + Intergenic
999274189 5:150318053-150318075 TGGGGGACAGAGTTCAGAACAGG + Intronic
1000296942 5:159920402-159920424 AGGGGGACAAAGTCTCAGAAAGG - Intronic
1000565412 5:162841018-162841040 TGGGGGACAAACCTGAAGAAGGG + Intergenic
1002216701 5:177640481-177640503 TGGGGTACATATTTTGAGACAGG + Intergenic
1002790841 6:436295-436317 TGGGGGACAGAGGTTAACTCAGG + Intergenic
1005234971 6:23749689-23749711 AAGGGTACAAAGTTTAAGTCAGG - Intergenic
1006524244 6:34590250-34590272 AGGGGGAAAAAGTTTAAAATGGG - Exonic
1010560077 6:77338628-77338650 GGGGGGACAAAGTTAAAGTGTGG - Intergenic
1015189578 6:130458041-130458063 TAGGGGACAAAGGTTCACACAGG - Intergenic
1015706410 6:136092814-136092836 AGGGGTACAAAGTCTCAGACAGG + Intronic
1016582644 6:145646586-145646608 TGAGGGACACAGTTTATGAAGGG - Intronic
1016889114 6:148988177-148988199 TGGGGTATAAAGTTTGAGGCAGG + Intronic
1016930786 6:149406178-149406200 TGGGGAACAAATTGTAAGTCTGG - Intronic
1017732459 6:157329689-157329711 TGGGGGACAAAGCTCATGCCAGG + Intergenic
1018334123 6:162766178-162766200 ATGGGGACAAAGTTTCAGATAGG - Intronic
1018857668 6:167687066-167687088 TGGGGGACAAAGGACAAGATGGG - Intergenic
1026599663 7:71767102-71767124 AGAGGGACAAAATTTAACACTGG - Intergenic
1026998681 7:74636426-74636448 TGGGGGACAGAGTTGTAAACAGG - Intergenic
1027756725 7:82223350-82223372 GGGGAAACAAATTTTAAGACTGG - Intronic
1027921630 7:84402915-84402937 TGGGGTAGAGAGTTGAAGACAGG + Intronic
1031942478 7:127803639-127803661 TGGGGTACAATGTTTAAGAATGG + Intronic
1034548602 7:151805896-151805918 TTGGTGACAAAGTTTAGGACAGG + Intronic
1037685834 8:21138767-21138789 TGGGGGAAGAGGTTGAAGACTGG - Intergenic
1046108138 8:109691323-109691345 TGGGCGAGAAAGGGTAAGACCGG - Exonic
1047707494 8:127514426-127514448 AGGGGGGCAGAGCTTAAGACTGG + Intergenic
1047799971 8:128298613-128298635 TGGGGGATAAAGTATAACCCAGG - Intergenic
1047967065 8:130053518-130053540 AGGTGGACAGAGCTTAAGACTGG + Exonic
1048900019 8:139028136-139028158 GGGGGGATAAAATTTAACACTGG - Intergenic
1053421039 9:37978569-37978591 TGGGGGGCAAAGTATAACGCAGG + Intronic
1053596657 9:39569163-39569185 TGGGAGACTAATTTTAAGAATGG - Intergenic
1053854626 9:42325804-42325826 TGGGAGACTAATTTTAAGAATGG - Intergenic
1054569600 9:66795839-66795861 TGGGAGACTAATTTTAAGAATGG + Intergenic
1056586043 9:87927900-87927922 TGTGGGACAAGGTTTCAGAAAGG - Intergenic
1056610839 9:88125043-88125065 TGTGGGACAAGGTTTCAGAAAGG + Intergenic
1057859186 9:98625960-98625982 CAGGGGACAGAGCTTAAGACAGG + Intronic
1059874281 9:118616770-118616792 TGGGGGGTATAGTTTAAAACTGG + Intergenic
1062214382 9:135381171-135381193 TGTGGGGCAAAGTTTCAGCCAGG - Intergenic
1203424793 Un_GL000195v1:27855-27877 TGGTGGTCAAAGTTAGAGACTGG + Intergenic
1185737415 X:2503887-2503909 TGGGGGCCAAAGTTCCAGATAGG - Intergenic
1187417719 X:19107306-19107328 TGGGAGACAAATTTTTAGGCAGG - Intronic
1188326419 X:28808201-28808223 CTTGAGACAAAGTTTAAGACTGG + Intronic
1189305648 X:39984786-39984808 TGGGGGCTAAAGTCCAAGACTGG + Intergenic
1189927525 X:45972357-45972379 TGTGGGACAAAGTTGAATAAGGG + Intergenic
1190906129 X:54730226-54730248 TCTGGAACAAGGTTTAAGACTGG - Intergenic
1192486442 X:71531135-71531157 TGGGTGACAAAGTTTGGGATTGG + Intronic
1194124703 X:90001503-90001525 AAGGGTACAAAGTTTTAGACAGG + Intergenic
1194583688 X:95707284-95707306 CGGAGGAAAAAGTTGAAGACAGG - Intergenic
1195985326 X:110623407-110623429 TGGGGGACAAAGTTAAAGTGTGG + Intergenic
1200391577 X:155951325-155951347 TTGGGGACAGAGTTCAAGTCAGG + Intergenic
1201613836 Y:15873581-15873603 TCAGGCACAAAGTTAAAGACAGG - Intergenic
1201962546 Y:19697873-19697895 TGTGGGATAAAGTTTTAAACAGG + Intergenic