ID: 992063494

View in Genome Browser
Species Human (GRCh38)
Location 5:73081875-73081897
Sequence ATACAATCCAGAAGCTATGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992063492_992063494 2 Left 992063492 5:73081850-73081872 CCACAGATCTTAGAGTGGATTAT 0: 1
1: 0
2: 0
3: 8
4: 114
Right 992063494 5:73081875-73081897 ATACAATCCAGAAGCTATGGTGG 0: 1
1: 0
2: 0
3: 14
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992063494 Original CRISPR ATACAATCCAGAAGCTATGG TGG Exonic
902380462 1:16050121-16050143 ATAGACTCCAGGAGATATGGGGG - Intronic
905916365 1:41687196-41687218 ACACAGTCCAGAGGATATGGGGG + Intronic
907752800 1:57279631-57279653 ATAAAATCCTGAGGCTATGGAGG - Intronic
908564403 1:65339837-65339859 ATAAAAAACAGAAGCCATGGTGG + Intronic
910153913 1:84191349-84191371 TTACAATCCAAAAGAGATGGGGG - Intronic
910643172 1:89486535-89486557 GTAAAATCCAGAAGCTAAGTGGG + Intergenic
915030436 1:152875687-152875709 ATACAAGACAGAAGCCAAGGAGG + Intergenic
917648733 1:177054878-177054900 AGCCAAACCACAAGCTATGGAGG + Intronic
917697058 1:177535954-177535976 CTACAATCCAGAAGAGATGGGGG + Intergenic
917699466 1:177565403-177565425 CTACAAGCCAGAAGCAGTGGGGG + Intergenic
918831762 1:189406888-189406910 AGATAATCAAGAAGATATGGAGG - Intergenic
920138685 1:203791436-203791458 ATAGAATACAGAAGAAATGGTGG + Intergenic
922820671 1:228483245-228483267 ATACAAACCTAAAGATATGGGGG - Intergenic
923952908 1:238980170-238980192 AAACAAACCAGAAGCTAGTGGGG + Intergenic
1063655553 10:7985084-7985106 ATTCACTCTAGAAGCTATGCAGG - Intronic
1066149982 10:32606158-32606180 GTACAAGCCATAAGCTTTGGTGG + Intronic
1067459522 10:46447459-46447481 CCACCACCCAGAAGCTATGGGGG - Intergenic
1067627668 10:47937154-47937176 CCACCACCCAGAAGCTATGGGGG + Intergenic
1070632688 10:78098185-78098207 ATACAAGCCAGAAGAGATTGGGG + Intergenic
1071968413 10:90876961-90876983 ATACAAACCAGCAGGTTTGGGGG + Intronic
1072019007 10:91380164-91380186 ATAAAATGCCAAAGCTATGGTGG - Intergenic
1073967916 10:109012833-109012855 AAACAATCCAGAATATATGAAGG - Intergenic
1075500272 10:122966678-122966700 CTACAACCCAGAAGATATTGGGG + Intronic
1076940505 10:133603757-133603779 ACACATTCCAGAGGCTATGAGGG - Intergenic
1078957877 11:16222816-16222838 ATAAAATTCAGAAGCTAAGTAGG + Intronic
1081181661 11:39992052-39992074 ATACAAGCCATAAGCCTTGGTGG + Intergenic
1081384486 11:42455395-42455417 ATAAAATTCAGATGCTGTGGGGG - Intergenic
1083641556 11:64148397-64148419 ACAAAATCCAGAAGCTCCGGCGG + Intronic
1087480796 11:98698234-98698256 TTAGAATCCAGAAGCTTGGGAGG - Intergenic
1088160337 11:106862449-106862471 ATAAAATCCAGAAGCTGTTCAGG - Intronic
1089482957 11:118821841-118821863 ACCCAAGCCAGAAGCAATGGCGG - Intergenic
1093612956 12:21184430-21184452 ATACAAGCCAGAAGAGATTGGGG + Intronic
1093960241 12:25264782-25264804 GTAAAATGCAAAAGCTATGGGGG - Intergenic
1095320197 12:40817990-40818012 CTACAAGCCAGAAGAGATGGGGG - Intronic
1096040013 12:48507036-48507058 ACACATTCCAGAGGCCATGGGGG - Intergenic
1096051543 12:48613902-48613924 ATACAAGCCAGAAGAGATTGAGG - Intergenic
1097415636 12:59313083-59313105 CTACAATCCAGAATCTATAAGGG + Intergenic
1098183520 12:67872860-67872882 ATACAGTCCAAGAGCTATGTGGG - Intergenic
1101187927 12:102300163-102300185 TTACAATCCAGAAGAGATTGGGG - Intergenic
1101681959 12:106977436-106977458 ATACAACACAGAAGCTAAGCAGG + Intronic
1104285384 12:127419899-127419921 ATACAAGCCAGAAGCCAAGCTGG + Intergenic
1106467725 13:30027628-30027650 TTCCAAGTCAGAAGCTATGGGGG + Intergenic
1106889181 13:34224960-34224982 AGACAATCCAGAAGCTACTCAGG + Intergenic
1107508515 13:41059968-41059990 ATACACACCACGAGCTATGGAGG - Intronic
1108125245 13:47235606-47235628 ATACAACCAAAATGCTATGGGGG - Intergenic
1110600576 13:77367947-77367969 ACACAAACTAGAAGATATGGAGG + Intergenic
1111179085 13:84638001-84638023 ATACAAGCCAGAAGAGATGGTGG + Intergenic
1115742934 14:36407064-36407086 ATAGAATCCAAAGGCTAGGGAGG + Intergenic
1117534229 14:56688650-56688672 ATAAAATCCAGAGGAAATGGTGG - Intronic
1117886726 14:60371855-60371877 ATGCAATCCATAAGCCTTGGTGG + Intergenic
1118504946 14:66400969-66400991 AAATGATCAAGAAGCTATGGAGG + Intergenic
1122030769 14:98909916-98909938 ATACAGTGCAGAAGAAATGGAGG + Intergenic
1123127192 14:105955580-105955602 GTACAATCCAGAAGAGATTGGGG + Intergenic
1126876791 15:53051451-53051473 CTACAATCCAGAAGAGATTGGGG + Intergenic
1129911845 15:79234458-79234480 ATACATTCCAGGGGCCATGGGGG + Intergenic
1130698429 15:86154702-86154724 TGACAATCCAGAGGCTGTGGAGG + Intronic
1130779366 15:87018428-87018450 CTACAAGCCAGAAGATATTGGGG + Intronic
1131631014 15:94176754-94176776 ATAGTCTCCAGAAGTTATGGTGG - Intergenic
1131937994 15:97528365-97528387 ATACCATTTAGAATCTATGGAGG - Intergenic
1137292792 16:47063374-47063396 ATCGGATCCAGAAGATATGGAGG + Intergenic
1138809923 16:60137904-60137926 TTACAATCCAGAAGAGATTGGGG - Intergenic
1138896667 16:61214022-61214044 ATGCAATCGGTAAGCTATGGGGG - Intergenic
1140166329 16:72555697-72555719 ATACCATTTAGAAGCTAAGGCGG + Intergenic
1140924964 16:79573480-79573502 ATGCTTTCCAGAAGATATGGGGG - Intergenic
1140943274 16:79743649-79743671 CTAGAATCCAGAATCTATGATGG + Intergenic
1145010862 17:19366900-19366922 ATGCAAACCAGAAGCTACAGGGG + Intronic
1147034103 17:37667251-37667273 ATTCAGACCAGAAGCCATGGAGG + Intergenic
1148804282 17:50256456-50256478 ATTCAGTCCAGAAGATATTGGGG - Intergenic
1153410377 18:4785816-4785838 ATACAATGCAGCAGATATGTAGG + Intergenic
1155672632 18:28389846-28389868 CTACAAGCCAGAAGATATTGGGG + Intergenic
1157205325 18:45693134-45693156 CTACAAGCCAGAAGCAATTGGGG + Intergenic
1158095678 18:53767737-53767759 ATACAAGCCAGAAGAGAAGGGGG + Intergenic
1158500412 18:57995786-57995808 ATACAAACTTGAAGATATGGGGG + Intergenic
1164422585 19:28108183-28108205 CTACAAGCCAGAAGGGATGGGGG + Intergenic
1166254586 19:41593627-41593649 TTACAAACCAGAAGGTATTGGGG - Intronic
1166588363 19:43971080-43971102 CTACAAGCCAGAAGATATTGGGG + Intronic
1167479858 19:49723312-49723334 ACACATTCCAGAGGCTATGAGGG - Intergenic
1167615475 19:50530523-50530545 ATTCAATCAATAAGCAATGGGGG - Intronic
1167727900 19:51231004-51231026 ACACATTCCAGAGGCTATGAGGG - Intronic
1168209428 19:54879570-54879592 CTACAATCCAGAAGAGATTGGGG - Intronic
1168628965 19:57942356-57942378 AAACACTTCAGAAGCAATGGGGG - Exonic
926354178 2:12024506-12024528 ACAGGATCCAGAAGTTATGGTGG + Intergenic
928494760 2:31820362-31820384 ATACAAGCCATAAGCCTTGGTGG - Intergenic
928628130 2:33161907-33161929 AAACAATTCAAAAGCCATGGGGG - Intronic
932057325 2:68459554-68459576 ATACAATCCTTAAGGTATGTGGG - Exonic
934578684 2:95420464-95420486 ATGCAATCCAGAAGCCCAGGGGG - Intergenic
934600759 2:95656245-95656267 ATGCAATCCAGAAGCCCAGGGGG + Intergenic
935374185 2:102378574-102378596 ATACAAACAAGAGGCCATGGGGG - Intronic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
936534133 2:113298383-113298405 ATGCAATCCAGAAGCCCAGGGGG + Intergenic
936810833 2:116399783-116399805 CTACAAGCCAGAAGCAATTGGGG + Intergenic
939930954 2:148232016-148232038 AAACAATCCAGAAGCTTTCAAGG + Intronic
940977829 2:159966110-159966132 ATACAATCAATTAGCTAAGGGGG + Intronic
941923671 2:170875378-170875400 ACCCCATCCAGAAGATATGGGGG - Intergenic
943151149 2:184115220-184115242 CTACATTCCAGAAGCTATGCTGG + Intergenic
943630111 2:190241790-190241812 ATACAATCCAGAAGAGAGTGGGG - Intronic
944603134 2:201323407-201323429 TTACAAGCCAGAAGGTATTGGGG + Intronic
945609429 2:211980661-211980683 ATACAATACTGAATCTAAGGAGG - Intronic
945896963 2:215494339-215494361 ATACTATCCAGAACATATGCTGG - Intergenic
1170299859 20:14871335-14871357 ATACAAGCCAGAAGAGATTGAGG + Intronic
1171370519 20:24659237-24659259 ATGCAATCCACAAGCTATTAAGG - Intronic
1171978090 20:31608090-31608112 ATAAAATCCATAAACTGTGGAGG - Intergenic
1172695348 20:36818649-36818671 TTAAAATCCAGAAGCAATAGGGG + Intronic
1172953804 20:38740560-38740582 TTATATTCCAGAAGCTATTGTGG - Intergenic
1173026467 20:39311835-39311857 TAACAATCCAGTAGTTATGGTGG - Intergenic
1174342835 20:49908516-49908538 CTCTAATCCAGAAGCCATGGAGG - Exonic
1176976910 21:15333066-15333088 CTACAAACCAGAAGATATTGGGG - Intergenic
1177134007 21:17291460-17291482 CTACAAGCCAGAAGAGATGGGGG + Intergenic
1177294517 21:19157425-19157447 ACACAAACTAGAAACTATGGAGG - Intergenic
1178322187 21:31614124-31614146 ATCCAATCCAGGAGCAATGGTGG + Intergenic
1179134610 21:38668549-38668571 TTGCACTCCAGAACCTATGGTGG + Intergenic
1181951009 22:26553829-26553851 ATACAATCTAAATGCTATGTAGG + Intronic
1182159959 22:28111733-28111755 ATAAAATCCAAAAGCTGTGAGGG - Intronic
1184800544 22:46756139-46756161 ATACAAGCCATAAGCCTTGGTGG - Intergenic
949754142 3:7390180-7390202 TTACAATCCAGAAGAGATTGGGG - Intronic
951429385 3:22588312-22588334 ATACATTTCAGAAGCTAAGCAGG + Intergenic
952007682 3:28861001-28861023 AGAAATTACAGAAGCTATGGGGG + Intergenic
952886558 3:38016023-38016045 ATACAATTCAGAAGGGAAGGAGG - Intronic
953079880 3:39606981-39607003 CTACAAACCAGAAGCTACTGGGG - Intergenic
953291796 3:41672524-41672546 ATACATTCCAGACACTAGGGAGG + Intronic
958064588 3:88527329-88527351 CTACAACCCAGAAGATATTGGGG - Intergenic
958072955 3:88638118-88638140 ACAAAATCTAGAAGATATGGAGG - Intergenic
958120081 3:89275283-89275305 CTAAAATCAAGAAGCTATGGTGG + Intronic
959220900 3:103518079-103518101 TTACAAGCCAGAAGATATTGGGG + Intergenic
959524300 3:107359235-107359257 AAAGAATCTAGAAGCTTTGGGGG - Intergenic
960346619 3:116540415-116540437 CTACAAGCCAGAAGAGATGGGGG + Intronic
960481004 3:118190226-118190248 AAACAAACAAGAAACTATGGAGG + Intergenic
962065847 3:131980022-131980044 ATACAAGCCAGAAGGGATTGAGG - Intronic
963270615 3:143282506-143282528 ATATAAGCCTGAATCTATGGAGG + Intronic
964244598 3:154636971-154636993 TTACAATCCAGAAGATGTTGGGG - Intergenic
964619963 3:158711511-158711533 ATCTAATCCAGAAGAAATGGGGG + Intronic
964694595 3:159492915-159492937 CTACAAGCCAGAAGAGATGGGGG + Intronic
966235091 3:177691993-177692015 AGGCAATAGAGAAGCTATGGAGG - Intergenic
967491053 3:190091209-190091231 ACACAATCCAGAAGCTAAAATGG - Intronic
967958536 3:194899505-194899527 CTACAAGCCAGAAGGGATGGGGG - Intergenic
968638926 4:1700171-1700193 ATGCAATCCAGAAGCTCCGTGGG + Intronic
972907451 4:43768377-43768399 ACACCATGCAGGAGCTATGGAGG - Intergenic
974914248 4:68160292-68160314 ATACAAGCCAGAAGAGATTGGGG - Intergenic
976538005 4:86241163-86241185 CTACAAGCCAGAAGATATTGGGG - Intronic
976640566 4:87333541-87333563 CTACAAGCCAGAAGATATTGGGG - Intergenic
977534263 4:98238554-98238576 ATCCAATCCAGAAGCTGCAGTGG + Intergenic
977678773 4:99775711-99775733 CTACAAGCCAGAAGAGATGGTGG + Intergenic
978315389 4:107430037-107430059 ATACAGGCAAGAAGTTATGGTGG + Intergenic
979375614 4:119943167-119943189 AAATAACCCAGAAGATATGGTGG + Intergenic
979969926 4:127121996-127122018 AAATAATTCAGAAGCTATTGTGG - Intergenic
980147998 4:129013632-129013654 CTACAAGCCAGAAGCAATTGGGG - Intronic
980324145 4:131319626-131319648 ATACAATCCAGAAGAAGTTGGGG - Intergenic
980469755 4:133235565-133235587 CTACAAGCCAGAAGAGATGGAGG + Intergenic
980645106 4:135634133-135634155 CTACAATCCAGAAGAAATTGGGG - Intergenic
981425904 4:144602851-144602873 TTACAAGCCAGAAGATATTGAGG + Intergenic
982859640 4:160433279-160433301 ATACAAGCCAGAAGAGATGGGGG - Intergenic
983115753 4:163814011-163814033 ATACATTCCAGAGGCTGTGAGGG - Intronic
983180195 4:164638927-164638949 ACACAACTCAGAAGCTTTGGAGG - Intergenic
983858409 4:172674290-172674312 CTACAATACAGAAGAGATGGAGG - Intronic
985944041 5:3162910-3162932 AGACAAACCAAAAGCTGTGGAGG - Intergenic
986838639 5:11671103-11671125 CTACAAGCCAGAAGAGATGGGGG - Intronic
986915952 5:12621366-12621388 CTACAAGCCAGAAGGTATTGGGG - Intergenic
987108373 5:14662975-14662997 ATTGAATCCAGAATCTCTGGTGG + Intergenic
987224454 5:15825138-15825160 ATAAAATCCATAAGCTATGACGG + Intronic
987572120 5:19677221-19677243 ATACAAGCCAGAAGCGATTGGGG + Intronic
987697827 5:21355069-21355091 ATACAAGCCTCAAGCTTTGGTGG - Intergenic
988754409 5:34231625-34231647 ATACAAGCCTCAAGCTTTGGTGG + Intergenic
989276602 5:39597467-39597489 ATACAAGCCAGAAGAGATTGGGG - Intergenic
990138890 5:52681000-52681022 CTACAAGCCAGAAGAGATGGGGG - Intergenic
990704930 5:58516973-58516995 ATACAAGCCAGAAGAGATTGGGG + Intergenic
990792613 5:59497989-59498011 ATACAAGCCAGAAGAGATTGGGG + Intronic
991742618 5:69697318-69697340 ATACAAGCCTCAAGCTTTGGTGG + Intergenic
991755076 5:69857886-69857908 ATACAAGCCTCAAGCTTTGGTGG - Intergenic
991794191 5:70277056-70277078 ATACAAGCCTCAAGCTTTGGTGG + Intergenic
991822008 5:70572631-70572653 ATACAAGCCTCAAGCTTTGGTGG + Intergenic
991834403 5:70733034-70733056 ATACAAGCCTCAAGCTTTGGTGG - Intergenic
991886569 5:71276598-71276620 ATACAAGCCTCAAGCTTTGGTGG + Intergenic
992063494 5:73081875-73081897 ATACAATCCAGAAGCTATGGTGG + Exonic
992792056 5:80222516-80222538 ATCCAACCCAGAAGTTTTGGTGG + Intronic
995082818 5:108074010-108074032 ATAGAGTCAAGAGGCTATGGGGG - Intronic
995255723 5:110044312-110044334 ATACAAGCCAGAAGAGATTGAGG - Intergenic
995289334 5:110432298-110432320 TTACAAACCAGAAGATATTGGGG + Intronic
997800057 5:136852079-136852101 CTACAAGCCAGAAGAGATGGGGG - Intergenic
998817963 5:146032612-146032634 AGACAATCCAGATGCTATCTTGG + Intronic
1000343386 5:160294719-160294741 CTCCACTCCAGAAGGTATGGGGG - Intronic
1001754169 5:174154768-174154790 ATGCAATCCAGAAGATAATGGGG - Intronic
1003082670 6:3034365-3034387 AGACAATCCTGAATCTAGGGTGG + Intergenic
1003606695 6:7568245-7568267 ACACTCTCCAGAAGCTATGCAGG - Intronic
1005080252 6:21949995-21950017 ATATATTCCAGGAGCTGTGGTGG + Intergenic
1005553024 6:26943335-26943357 ATACAAGCCTCAAGCTTTGGTGG + Intergenic
1011380054 6:86733008-86733030 CTACAAGCCAGAAGAGATGGGGG + Intergenic
1012416393 6:99018335-99018357 TGAGAATCCAGATGCTATGGGGG - Intergenic
1013849082 6:114492319-114492341 ATACTAAACAGAAGCTTTGGAGG + Intergenic
1015045193 6:128768254-128768276 ATACAAGCCACAAGCCTTGGTGG - Intergenic
1016097183 6:140052609-140052631 ATATTATCCAGAAGCTGTGAAGG - Intergenic
1019031421 6:169016984-169017006 ATACAAGCCAGAAGAGATTGGGG - Intergenic
1020867768 7:13588991-13589013 ATACAAGCCAGAAGAGATTGAGG - Intergenic
1022961628 7:35431775-35431797 ATACAAGCCAGAAGAGATTGGGG + Intergenic
1023760279 7:43459190-43459212 GCACATTCCAGAAGCTATAGGGG - Intronic
1024174912 7:46829022-46829044 ATACAATCCAGAAGGAATTGGGG + Intergenic
1026058386 7:67005091-67005113 CTACAATCCAGAAGAGATTGGGG - Intronic
1026719705 7:72819935-72819957 CTACAATCCAGAAGAGATTGGGG + Intronic
1028019488 7:85751856-85751878 ATACAAGCCAGAAGAGATTGGGG + Intergenic
1028329843 7:89576554-89576576 CTATAATCCAGAAGATATTGGGG + Intergenic
1028734164 7:94188327-94188349 ATACAAGCCAGAAGAGATTGGGG - Intergenic
1031311777 7:120207604-120207626 CTACAAGCCAGAAGAGATGGGGG + Intergenic
1032776092 7:135114693-135114715 AAACAATCCAGGAGAGATGGCGG - Intronic
1034404858 7:150896547-150896569 ACACAATCAAAAAACTATGGTGG + Intergenic
1034603683 7:152289193-152289215 ACACGATGCAAAAGCTATGGTGG + Intronic
1036790496 8:11715071-11715093 ATACAAACCATAAGCTATGTAGG + Intronic
1037749632 8:21672803-21672825 ATACAAGCCACTATCTATGGGGG - Intergenic
1039984951 8:42439300-42439322 AGAAAACCCAGAAGCTAGGGAGG - Intronic
1043092750 8:75925703-75925725 CTACAAGCCAGAAGATATTGAGG + Intergenic
1043299065 8:78704424-78704446 CTACAAGCCAGAAGATATTGGGG - Intronic
1044028911 8:87210637-87210659 GTACAAGCCATAAGCTTTGGTGG + Intronic
1046148995 8:110199090-110199112 AGACAATCCAGGTACTATGGTGG - Intergenic
1046735716 8:117774704-117774726 CTACAAGCCAGAAGAGATGGGGG + Intergenic
1046740518 8:117823043-117823065 ACACATTCTAGAAGCTATTGAGG + Intronic
1051035979 9:12746045-12746067 CTACAAGCCAGAAGATATAGGGG - Intergenic
1052364040 9:27591111-27591133 TTACAAGCCAGAAGATATGGGGG + Intergenic
1052369435 9:27647000-27647022 ATACAAGCCAGAAGAGATTGGGG + Intergenic
1053548357 9:39047627-39047649 ATACAAGCCAGAAGAGATAGGGG + Intergenic
1053812482 9:41867688-41867710 ATACAAGCCAGAAGAGATAGGGG + Intergenic
1054618113 9:67319751-67319773 ATACAAGCCAGAAGAGATAGGGG - Intergenic
1055276071 9:74617967-74617989 ATTCAATTCTGAAGCAATGGAGG + Intronic
1055464177 9:76547584-76547606 AGACAATCCACAGGCTATGAAGG - Intergenic
1055560909 9:77520769-77520791 AAACAATCCAGAAACTAGTGAGG - Intronic
1058784403 9:108373076-108373098 CTACAAGCCAGAAGGTATTGGGG - Intergenic
1058841040 9:108909362-108909384 AAACAATCAAGAAGCAATGAGGG + Intronic
1060686586 9:125619750-125619772 TCAAAATCCAGAAGCTATAGAGG + Intronic
1185784648 X:2880376-2880398 ATACAAAACAGAAGTTTTGGTGG + Intronic
1187818337 X:23257378-23257400 CTACAATCCAGAAGAGATTGGGG + Intergenic
1188091515 X:25970220-25970242 TTACAAGCCAGAAGAGATGGGGG + Intergenic
1191087114 X:56580860-56580882 TTACATGCCAGAAGATATGGGGG - Intergenic
1191973123 X:66839456-66839478 ATACAATCCAGAAGGTAGTGGGG + Intergenic
1192693789 X:73393014-73393036 CTACAAGCCAGAAGTTTTGGGGG + Intergenic
1193036410 X:76956355-76956377 ATACAAACCAGAAGATATTGGGG - Intergenic
1193039478 X:76989167-76989189 CTACAATCCAGAAGAGATTGGGG + Intergenic
1193425311 X:81335480-81335502 CTACAATCCAGAAGAGATTGGGG - Intergenic
1193496267 X:82217511-82217533 CTACAATCCAGAAGAGATTGGGG - Intergenic
1193526787 X:82600184-82600206 TTACAAGCCAGAAGATATTGAGG + Intergenic
1193637471 X:83969662-83969684 ATACAAGCCAGAAGAGATTGGGG + Intergenic
1193779084 X:85681239-85681261 TTACAATCCAGGAGATATTGGGG - Intergenic
1193879825 X:86908361-86908383 ATACAAGCCATAAACTTTGGTGG - Intergenic
1193908987 X:87279359-87279381 CTACAAGCCAGAAGGTATTGGGG - Intergenic
1194471701 X:94304923-94304945 TTACAAGCCATAAGCTTTGGTGG - Intergenic
1194854513 X:98913287-98913309 CTACAAGCCAGAAGATATTGGGG - Intergenic
1195151734 X:102078155-102078177 ATAAAATCCAGAAGCAATAAAGG + Intergenic
1196066654 X:111471508-111471530 ATGCAAGCCAGAAGCCTTGGTGG - Intergenic
1197403741 X:126026050-126026072 ATACAAGCCAGAAGAGATTGGGG - Intergenic
1201739229 Y:17305539-17305561 CTACAAGCCAGAAGATATTGGGG + Intergenic