ID: 992067478

View in Genome Browser
Species Human (GRCh38)
Location 5:73120778-73120800
Sequence CCGCGGCAGCGCGGAGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 293}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992067465_992067478 30 Left 992067465 5:73120725-73120747 CCGGCGGCGGCGGGTCGGGCGCT 0: 1
1: 0
2: 0
3: 10
4: 119
Right 992067478 5:73120778-73120800 CCGCGGCAGCGCGGAGGCGCTGG 0: 1
1: 0
2: 6
3: 38
4: 293
992067473_992067478 -4 Left 992067473 5:73120759-73120781 CCAGGCTGGGCGCGGGGAGCCGC 0: 1
1: 0
2: 4
3: 77
4: 431
Right 992067478 5:73120778-73120800 CCGCGGCAGCGCGGAGGCGCTGG 0: 1
1: 0
2: 6
3: 38
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992067478 Original CRISPR CCGCGGCAGCGCGGAGGCGC TGG Intronic