ID: 992067593

View in Genome Browser
Species Human (GRCh38)
Location 5:73121827-73121849
Sequence TCACATCCATGGTCCCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992067593_992067597 14 Left 992067593 5:73121827-73121849 CCTTCATGGGACCATGGATGTGA 0: 1
1: 0
2: 1
3: 6
4: 121
Right 992067597 5:73121864-73121886 TTTAAAAGTTTTCTTTCCTTGGG 0: 1
1: 0
2: 10
3: 133
4: 1285
992067593_992067598 18 Left 992067593 5:73121827-73121849 CCTTCATGGGACCATGGATGTGA 0: 1
1: 0
2: 1
3: 6
4: 121
Right 992067598 5:73121868-73121890 AAAGTTTTCTTTCCTTGGGCAGG 0: 1
1: 0
2: 3
3: 27
4: 345
992067593_992067596 13 Left 992067593 5:73121827-73121849 CCTTCATGGGACCATGGATGTGA 0: 1
1: 0
2: 1
3: 6
4: 121
Right 992067596 5:73121863-73121885 TTTTAAAAGTTTTCTTTCCTTGG 0: 1
1: 2
2: 10
3: 146
4: 1209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992067593 Original CRISPR TCACATCCATGGTCCCATGA AGG (reversed) Intronic