ID: 992071240

View in Genome Browser
Species Human (GRCh38)
Location 5:73151235-73151257
Sequence GGTCCCCAGGGCCCACAAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992071240_992071251 9 Left 992071240 5:73151235-73151257 CCGCTTTGTGGGCCCTGGGGACC No data
Right 992071251 5:73151267-73151289 GTATTTTCCTAGGGGTGGGAAGG No data
992071240_992071245 -1 Left 992071240 5:73151235-73151257 CCGCTTTGTGGGCCCTGGGGACC No data
Right 992071245 5:73151257-73151279 CAAGGCCAGAGTATTTTCCTAGG No data
992071240_992071256 25 Left 992071240 5:73151235-73151257 CCGCTTTGTGGGCCCTGGGGACC No data
Right 992071256 5:73151283-73151305 GGGAAGGTGGAAGGGCCTTCAGG No data
992071240_992071252 12 Left 992071240 5:73151235-73151257 CCGCTTTGTGGGCCCTGGGGACC No data
Right 992071252 5:73151270-73151292 TTTTCCTAGGGGTGGGAAGGTGG No data
992071240_992071246 0 Left 992071240 5:73151235-73151257 CCGCTTTGTGGGCCCTGGGGACC No data
Right 992071246 5:73151258-73151280 AAGGCCAGAGTATTTTCCTAGGG No data
992071240_992071250 5 Left 992071240 5:73151235-73151257 CCGCTTTGTGGGCCCTGGGGACC No data
Right 992071250 5:73151263-73151285 CAGAGTATTTTCCTAGGGGTGGG No data
992071240_992071249 4 Left 992071240 5:73151235-73151257 CCGCTTTGTGGGCCCTGGGGACC No data
Right 992071249 5:73151262-73151284 CCAGAGTATTTTCCTAGGGGTGG No data
992071240_992071254 16 Left 992071240 5:73151235-73151257 CCGCTTTGTGGGCCCTGGGGACC No data
Right 992071254 5:73151274-73151296 CCTAGGGGTGGGAAGGTGGAAGG No data
992071240_992071255 17 Left 992071240 5:73151235-73151257 CCGCTTTGTGGGCCCTGGGGACC No data
Right 992071255 5:73151275-73151297 CTAGGGGTGGGAAGGTGGAAGGG No data
992071240_992071247 1 Left 992071240 5:73151235-73151257 CCGCTTTGTGGGCCCTGGGGACC No data
Right 992071247 5:73151259-73151281 AGGCCAGAGTATTTTCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992071240 Original CRISPR GGTCCCCAGGGCCCACAAAG CGG (reversed) Intergenic
No off target data available for this crispr