ID: 992073525

View in Genome Browser
Species Human (GRCh38)
Location 5:73170556-73170578
Sequence CAGCCTCACTGTGCCCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992073525_992073532 -3 Left 992073525 5:73170556-73170578 CCTGAAGGGGCACAGTGAGGCTG No data
Right 992073532 5:73170576-73170598 CTGATTGGAGGGCAGGAGGAGGG No data
992073525_992073533 3 Left 992073525 5:73170556-73170578 CCTGAAGGGGCACAGTGAGGCTG No data
Right 992073533 5:73170582-73170604 GGAGGGCAGGAGGAGGGTTCTGG No data
992073525_992073531 -4 Left 992073525 5:73170556-73170578 CCTGAAGGGGCACAGTGAGGCTG No data
Right 992073531 5:73170575-73170597 GCTGATTGGAGGGCAGGAGGAGG No data
992073525_992073529 -10 Left 992073525 5:73170556-73170578 CCTGAAGGGGCACAGTGAGGCTG No data
Right 992073529 5:73170569-73170591 AGTGAGGCTGATTGGAGGGCAGG No data
992073525_992073530 -7 Left 992073525 5:73170556-73170578 CCTGAAGGGGCACAGTGAGGCTG No data
Right 992073530 5:73170572-73170594 GAGGCTGATTGGAGGGCAGGAGG No data
992073525_992073535 26 Left 992073525 5:73170556-73170578 CCTGAAGGGGCACAGTGAGGCTG No data
Right 992073535 5:73170605-73170627 AAACTGGAACTGTTACTGCCAGG No data
992073525_992073534 10 Left 992073525 5:73170556-73170578 CCTGAAGGGGCACAGTGAGGCTG No data
Right 992073534 5:73170589-73170611 AGGAGGAGGGTTCTGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992073525 Original CRISPR CAGCCTCACTGTGCCCCTTC AGG (reversed) Intergenic
No off target data available for this crispr