ID: 992073534

View in Genome Browser
Species Human (GRCh38)
Location 5:73170589-73170611
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992073524_992073534 11 Left 992073524 5:73170555-73170577 CCCTGAAGGGGCACAGTGAGGCT No data
Right 992073534 5:73170589-73170611 AGGAGGAGGGTTCTGGAAACTGG No data
992073525_992073534 10 Left 992073525 5:73170556-73170578 CCTGAAGGGGCACAGTGAGGCTG No data
Right 992073534 5:73170589-73170611 AGGAGGAGGGTTCTGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr