ID: 992073896

View in Genome Browser
Species Human (GRCh38)
Location 5:73173663-73173685
Sequence CTGGAGAACCATAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 307}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992073896_992073905 16 Left 992073896 5:73173663-73173685 CCCTCCTCCTTATGGTTCTCCAG 0: 1
1: 0
2: 2
3: 21
4: 307
Right 992073905 5:73173702-73173724 TACCAGCTACCTGCAGTCTGTGG 0: 1
1: 0
2: 2
3: 82
4: 1207
992073896_992073908 29 Left 992073896 5:73173663-73173685 CCCTCCTCCTTATGGTTCTCCAG 0: 1
1: 0
2: 2
3: 21
4: 307
Right 992073908 5:73173715-73173737 CAGTCTGTGGTGAGCCCCTGCGG 0: 1
1: 0
2: 0
3: 18
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992073896 Original CRISPR CTGGAGAACCATAAGGAGGA GGG (reversed) Exonic
900536577 1:3180717-3180739 CTGGAGACCCCTCAGGAGGAAGG - Intronic
901104399 1:6743993-6744015 CTGGCAAACATTAAGGAGGAAGG - Intergenic
901186595 1:7377387-7377409 ATAGAGAACAGTAAGGAGGAGGG - Intronic
901536066 1:9883667-9883689 CAGGAGGACCATGAGGAGGGAGG - Intronic
901775332 1:11556726-11556748 CCGCAGAATCAAAAGGAGGATGG + Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
905044114 1:34983048-34983070 CTGGAGAACCTTGAACAGGAAGG - Intronic
905794355 1:40807274-40807296 CTGGAGAGTCACAAGGCGGAAGG + Intronic
908185533 1:61649322-61649344 CTGGAAAATCATTAGGAGGAAGG - Intergenic
908780967 1:67689347-67689369 CAGGGGAGCCATAAGGGGGACGG - Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
916404612 1:164485632-164485654 CTGGAGAACTCTCAGCAGGATGG + Intergenic
916450365 1:164914981-164915003 TTGGAGAACTATAAGGAGAGGGG + Intergenic
917432139 1:174981340-174981362 CTGAGGAACCATTAGTAGGACGG - Intronic
917582171 1:176390330-176390352 CTGGAGTACCTGAAGGAGAAGGG - Intergenic
917603772 1:176604003-176604025 CTGGAGTGCAATAAGGAGCATGG - Intronic
921009694 1:211129014-211129036 CTGGAGAACCATCAGGAGGGAGG + Intronic
923267372 1:232327768-232327790 TTGGGGAACAATAAGGAGGGAGG - Intergenic
1063414813 10:5864691-5864713 CTGGAGATCCATAATGGGGACGG - Intronic
1063818351 10:9804545-9804567 GTGGAAAACCATCAGAAGGAAGG + Intergenic
1064005687 10:11697117-11697139 CTGAACAACCAGAAGGATGAAGG - Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064366790 10:14715789-14715811 CTTGAGAACCACCAGGAGGTTGG - Intronic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1064755478 10:18568919-18568941 ATGGAGAACCAAATGGAGAATGG - Intronic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1067909542 10:50332174-50332196 CTGGAGAATGATAGGGAGGGTGG - Intronic
1068726574 10:60309617-60309639 CTGGAGATGAATAAGGAGGTTGG + Intronic
1071134412 10:82437152-82437174 TTGGAGTACCAGAAGGAGAAGGG - Intronic
1071712983 10:88067865-88067887 CTGGAGCACCATCAGGAAGGGGG + Intergenic
1071763888 10:88639910-88639932 CTAGAGAACCTTATGAAGGAAGG - Intergenic
1072191797 10:93081829-93081851 CTGGAGAAACATAAGGTAAATGG - Intergenic
1074700517 10:116088090-116088112 ATGGAGAACCAGAAGGACAAAGG + Intronic
1075661976 10:124203930-124203952 CTGCAGAACCTTCAGGAGGATGG + Intergenic
1075774265 10:124969839-124969861 GTTGAGAACCATAAGGTTGAAGG + Intronic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1077208800 11:1358503-1358525 CTGGAGAGCCATAGCCAGGAGGG - Intergenic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1078028527 11:7723691-7723713 CTGGGGAAACAAAAGAAGGAAGG - Intergenic
1078750963 11:14163449-14163471 CTGGAGAAATAAAAGGAGAATGG - Intronic
1079181036 11:18193745-18193767 CTGCAGAATCACAAGGATGAGGG - Intronic
1079481987 11:20890884-20890906 CTGGAGTACCAGAAGGAGACAGG + Intronic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1083049394 11:59763414-59763436 CTGGAGAAGCAAAAGCAGGTAGG + Intronic
1083687038 11:64382682-64382704 ATGGAGGACCGTATGGAGGAGGG - Intergenic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1085230358 11:74962692-74962714 ATGGAGAACCATCTGGAAGAAGG - Intronic
1089281884 11:117380536-117380558 CTTGAGAGCCAGCAGGAGGATGG + Intronic
1089649074 11:119900462-119900484 CTGGAGAATGATACGGGGGAAGG - Intergenic
1089777231 11:120846866-120846888 CTGGAAAACCGTGAAGAGGAGGG - Intronic
1090017317 11:123097749-123097771 CAGGAGGACAAGAAGGAGGAGGG + Intronic
1091689795 12:2588187-2588209 CGGGAGAACAAGAAGCAGGAAGG - Intronic
1091770234 12:3146665-3146687 GTGGAGAAAGATAAGGAGGCAGG - Intronic
1092202079 12:6591719-6591741 CTCAAGAACCTTAAGGAGGGTGG - Exonic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093522654 12:20068299-20068321 TTGGAGTACCATAAGGAGAGGGG + Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1097033639 12:56107362-56107384 CTAGAGAAGCAAAAGGAGAAAGG + Intronic
1097410223 12:59243334-59243356 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097749118 12:63332129-63332151 CTGGAGTACCAGAAGGAGACAGG + Intergenic
1097882378 12:64698096-64698118 CTGGGGAACCACAGGGACGATGG + Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1102269126 12:111516193-111516215 CTGGAGAACCATGAGCAGAGGGG + Exonic
1103833876 12:123803394-123803416 CTGGAGCACCATGGGGAGAAAGG - Intronic
1104164699 12:126216489-126216511 CTGGAGAACAATGAGGGAGAGGG - Intergenic
1104294100 12:127496047-127496069 CTGGAGAACCATCAGGATGATGG - Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106636558 13:31534847-31534869 CAAAAGAAACATAAGGAGGAAGG - Intergenic
1107205782 13:37785830-37785852 CTGGAGAACTTTGAGGAAGAGGG + Intronic
1107763149 13:43703297-43703319 CTGTAGAAACATAAAGAGTATGG + Intronic
1108160568 13:47633848-47633870 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1108176593 13:47798740-47798762 CTGGAGAGGCAAAAGGAGGCAGG + Intergenic
1108346616 13:49552689-49552711 CTGCAGAACAGCAAGGAGGAAGG + Intronic
1108807476 13:54176715-54176737 ATGCAGACCCAAAAGGAGGAAGG + Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1110130760 13:72006590-72006612 CTTGAGACCCATAAGAAGCATGG + Intergenic
1111372553 13:87336026-87336048 CTGGAGATCCATACTGAGGATGG - Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1114451719 14:22830794-22830816 CTGGAGTCTCATAAGGAGAATGG - Intronic
1114479754 14:23025380-23025402 CTGGAGGACCAAAAGGACAAGGG + Intronic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115315254 14:32018622-32018644 CTAGAGAAACAATAGGAGGAGGG - Exonic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1119193860 14:72702627-72702649 CTGCAGAACCATCTGGGGGATGG + Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1120472360 14:84942126-84942148 CTTGAGAACCTTAGGCAGGAGGG - Intergenic
1121873257 14:97428561-97428583 CTCCAGAACCATATAGAGGAAGG - Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123460192 15:20462914-20462936 TTGGAGAACCATAATAACGATGG - Intergenic
1123657870 15:22537503-22537525 TTGGAGAACCATAATAACGATGG + Intergenic
1124266412 15:28238685-28238707 TTGGAGAACCATAATAAAGATGG - Exonic
1124311781 15:28632702-28632724 TTGGAGAACCATAATAACGATGG + Intergenic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126552838 15:49952311-49952333 TTGGAGGACCAGAAGGAGAAGGG - Intronic
1128443200 15:67732726-67732748 CTGGAGCTCCATATGGAGCAGGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1131059923 15:89398308-89398330 CTGGAGAAGCGTAAGTAGGAGGG + Intergenic
1131215410 15:90531028-90531050 TTGGAGGACCATCGGGAGGATGG + Intronic
1131325130 15:91435959-91435981 CTGAAGTAGCATAAGGAGCATGG - Intergenic
1131959815 15:97777526-97777548 TTCCAAAACCATAAGGAGGAGGG + Intergenic
1132042745 15:98538652-98538674 TTGGAGAACTAGAAGGAGCAAGG - Intergenic
1133077224 16:3289223-3289245 CTGGAGAAGCATCAGGATAAAGG - Intronic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133641795 16:7724262-7724284 CCAGACAAACATAAGGAGGAAGG - Intergenic
1133773838 16:8883229-8883251 GAGGAGGACCATAGGGAGGAGGG - Intergenic
1134194837 16:12151664-12151686 ATGTAAAACCATAATGAGGAGGG - Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136404548 16:30036612-30036634 CTGGCGGGCCATTAGGAGGATGG - Intronic
1136704607 16:32176098-32176120 TTGGAGAACCATAATAAAGATGG - Intergenic
1136763306 16:32753308-32753330 TTGGAGAACCATAATAAAGATGG + Intergenic
1136804794 16:33117078-33117100 TTGGAGAACCATAATAAAGATGG - Intergenic
1137392205 16:48091245-48091267 CTGCAGAACCCGAAGGAGGAAGG - Intronic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138928979 16:61629159-61629181 CGGGAGAAAGACAAGGAGGAAGG + Intergenic
1140126810 16:72124762-72124784 CTTGAGGACGATAAGGAGGTGGG - Exonic
1141602609 16:85135582-85135604 CTGGAGAAACTTCAGAAGGAAGG - Intergenic
1203065456 16_KI270728v1_random:1013629-1013651 TTGGAGAACCATAATAAAGATGG + Intergenic
1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG + Intergenic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144136700 17:12302117-12302139 CTGGAGACCGAGAAGGAGAATGG - Intergenic
1144200286 17:12934868-12934890 CAGGAGTACCACAAGGAGGCTGG + Intronic
1145102825 17:20090891-20090913 ATGGAGACCCATAAGGAATAGGG - Intronic
1145102831 17:20090920-20090942 CTGGAGACCCATAAGGAATAGGG - Intronic
1151122740 17:71810529-71810551 ATGGAAAACCAAAACGAGGAGGG + Intergenic
1152315404 17:79577745-79577767 CTGGAAAACCCAAAGGAGAAGGG + Intergenic
1153899982 18:9609691-9609713 CTGGAGAATGATAGAGAGGATGG - Intronic
1154465645 18:14641261-14641283 CGGGAGAACGAAAAAGAGGATGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1157210940 18:45741331-45741353 CTTGGGAACAAAAAGGAGGAGGG + Intronic
1158860893 18:61591394-61591416 CTGGAGAACTCTCAGGAGGCAGG - Intergenic
1158971750 18:62674602-62674624 CTGAAGAACTAAAAGCAGGAAGG - Intergenic
1160837481 19:1131678-1131700 CTGGAGAAGCCTCAGGTGGAGGG - Intronic
1162148807 19:8630709-8630731 CTGGAGAGCCAGGAGGAGCAAGG + Intergenic
1162575753 19:11497844-11497866 CTGGAGAAACCTAAGAAGGGAGG + Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163672039 19:18635384-18635406 CTGGAGACCCCATAGGAGGAAGG - Intergenic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164558702 19:29273545-29273567 CTGGAGCACATTATGGAGGAGGG - Intergenic
1165722389 19:38088789-38088811 CTGGAAGACCACAAGGAGCACGG + Exonic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
924979872 2:209801-209823 CTGGAGAAACATAAATTGGAGGG - Intergenic
925071321 2:969929-969951 CTGGAGAACCAGAAGCAGACAGG - Intronic
925433102 2:3814138-3814160 CTGGAGTACCAAAAGGAGGTGGG - Intronic
925482647 2:4293224-4293246 GTGGAGAAGGATAAGGATGAGGG - Intergenic
927710810 2:25324740-25324762 CTGGGGATGGATAAGGAGGAGGG + Intronic
929585871 2:43113991-43114013 CAGCAGAGCCATAAGGTGGAAGG + Intergenic
930307926 2:49699853-49699875 TTGGAGAAGCCTAAGAAGGATGG - Intergenic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930362162 2:50394845-50394867 CTGGAGGAGCATGAGCAGGAAGG - Intronic
931998207 2:67859099-67859121 CTGAATCACCATATGGAGGATGG + Intergenic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
935506572 2:103911984-103912006 CTGGAGTACCAGAAGGAGACAGG + Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936444698 2:112586411-112586433 CTGAACAACCAGAAGGATGAAGG - Intronic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
937931664 2:127209890-127209912 CTGGAGCACCAGAAGGAGACGGG + Intronic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
939809126 2:146809409-146809431 CTGGAGTACCAGAAGGAGATGGG + Intergenic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
941780717 2:169441591-169441613 CTGGAGAACTAAAAAGATGAAGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942999754 2:182311511-182311533 CTGTAGGACCAGAAGTAGGAAGG - Intronic
943522867 2:188975820-188975842 GTGGAGAGAGATAAGGAGGAGGG - Intronic
944928240 2:204487726-204487748 CTGGAGAACCATTTGGAAGTAGG - Intergenic
945228761 2:207561361-207561383 CTGGACTACCATTAGGAAGAGGG - Intronic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169792058 20:9421631-9421653 GAGGAGAACCAAAAGGAGGCAGG - Intronic
1170228779 20:14021901-14021923 CTGGAGAACCTTAGGGGGAAGGG + Intronic
1171084093 20:22219958-22219980 CTGGAGAAAGATAAGGAGCCAGG - Intergenic
1172299032 20:33835429-33835451 CTGGAGTCCCCAAAGGAGGAGGG - Intronic
1173074176 20:39800954-39800976 CTGGAGAACCAAAAGGAAGCAGG - Intergenic
1176808912 21:13517221-13517243 CGGGAGAACGAAAAAGAGGATGG + Intergenic
1178675145 21:34624912-34624934 GTGGAGAACCATGAGCAGCATGG + Intergenic
1181236031 22:21448172-21448194 CAGGGGAACCATGAGGAGGGTGG + Exonic
1182938791 22:34254062-34254084 CTGGAGTACCAAAAGGAGATGGG - Intergenic
1183005011 22:34894107-34894129 CTGCAGAATCATAAGTAAGATGG - Intergenic
1183553427 22:38506713-38506735 CTTGATAACAATATGGAGGACGG - Intronic
1184057391 22:42061508-42061530 CTGGAAAACCTTCTGGAGGATGG - Intronic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
1185234770 22:49705352-49705374 CAGGAGAACCACGAGGAGGACGG + Intergenic
949864207 3:8533815-8533837 CTGCAGAACGATTAGGAGCATGG - Intronic
951685611 3:25340730-25340752 CTGGAGAACAAGAAGGAAGTAGG + Intronic
952995597 3:38878813-38878835 CTGGAGAACCATAATGTTGTTGG - Intronic
953042415 3:39267182-39267204 AGGGAGAACCATGAGCAGGAGGG + Intronic
953361257 3:42299260-42299282 CTGCAGAACATTAAGGATGAAGG + Intergenic
953363820 3:42324846-42324868 CTGGAGAAGCATAAGCAAGTGGG - Intergenic
954030204 3:47813815-47813837 CTGGAGATACACAAGGAGGCAGG - Intronic
954149816 3:48651791-48651813 CTGGGGAACCTGAAGGAGGCAGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
959515982 3:107267612-107267634 CTGGAGAACTATATCTAGGAAGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
961321346 3:126078496-126078518 CCCCAGAACCATGAGGAGGAAGG + Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
965882813 3:173408132-173408154 CTAGAGAACCATATGTAGGCAGG - Intronic
966926983 3:184651036-184651058 CTGAAGAACCTCAAGCAGGATGG + Intronic
967540775 3:190665139-190665161 CTGGAGAAGGATAGGGCGGATGG + Intergenic
968692278 4:1998676-1998698 CTGGAGTACCAGAAGGAGACGGG + Intronic
968972255 4:3802185-3802207 CTGGGGCACCCCAAGGAGGATGG + Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970564733 4:17320686-17320708 TTGGAGAACCAAAAAGAAGAAGG - Intergenic
970652496 4:18193941-18193963 TTGGAGAAATATAAGCAGGATGG + Intergenic
970838382 4:20438135-20438157 TTGGAGAATCATAAGAAGGGAGG - Intronic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
971578467 4:28305518-28305540 GTGGGGAACCATACGGGGGATGG - Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
978136406 4:105266785-105266807 TTGGAGTACCAGAAGGAGGTGGG + Intronic
979652743 4:123155001-123155023 CAAGAGAACAATAAGGAGGAGGG - Intronic
982050737 4:151498882-151498904 CAGAAAAACAATAAGGAGGAAGG - Intronic
986482979 5:8207518-8207540 CCAGATAACCATAAGGAAGATGG - Intergenic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
988059646 5:26150046-26150068 CTGGAGTACCAGAAGGAGACAGG + Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
989204386 5:38796980-38797002 CTGCAGAACCAGAAGTAGGGTGG - Intergenic
989322359 5:40151199-40151221 CTGGAGGAGCAAAAGGAAGAAGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992588708 5:78270854-78270876 CTACAGAATCAAAAGGAGGAGGG - Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
992950061 5:81850023-81850045 ATGGAGAACAATAAAGCGGAAGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
1003284262 6:4721131-4721153 CAGGATAACCATATGCAGGAAGG + Intronic
1003526972 6:6906226-6906248 CTGGAGAACCACAAGGGAGCAGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1005214064 6:23504429-23504451 CAGGAGAACAGAAAGGAGGAAGG - Intergenic
1005725956 6:28648990-28649012 TTGAAGAACCAAAATGAGGAAGG - Intergenic
1006309933 6:33250234-33250256 CTGAAAAACCTTCAGGAGGAAGG + Intergenic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1011013175 6:82724829-82724851 CTGGACAACCTCAAGGAGGCGGG + Intergenic
1011113783 6:83867335-83867357 TTGGAGAATTATAAGAAGGAAGG + Intronic
1013648463 6:112169253-112169275 CTGGAGAACCCAGAGCAGGAGGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016848950 6:148597099-148597121 CTGCAAAACCATAACAAGGATGG + Intergenic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017661458 6:156678193-156678215 CTGGAAAACCTTAAGAAGAAAGG - Intergenic
1018677488 6:166235762-166235784 CTGGCCAACCATAAGAAGTACGG + Intergenic
1018880128 6:167869577-167869599 CTGGAGAACACTAAGGAAGCAGG - Intronic
1019660186 7:2219775-2219797 CTGGAGCACCAGGAGGAGGGTGG - Intronic
1021059991 7:16099457-16099479 CAGGAAAAACATAAGGAGAAGGG + Intronic
1022131058 7:27405027-27405049 ATGGAGAACCAAAAATAGGAAGG + Intergenic
1024019130 7:45349209-45349231 CTGGAGGATCACCAGGAGGATGG + Intergenic
1024105422 7:46079731-46079753 CTTGAGAACTATAAGGAGGCCGG + Intergenic
1025753656 7:64314106-64314128 TGGGAGATCCATAGGGAGGACGG + Exonic
1026388722 7:69878256-69878278 TAGGAGAACCCTAAGGTGGAGGG + Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1028210568 7:88069196-88069218 AAGGAGAAACATAGGGAGGAAGG - Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028570909 7:92286118-92286140 TTGGAGAAAAATAAGGAGAATGG - Intronic
1029750378 7:102539626-102539648 CAGGAGGACCGTGAGGAGGACGG + Intronic
1029768330 7:102638734-102638756 CAGGAGGACCGTGAGGAGGACGG + Exonic
1029806854 7:103007137-103007159 CTGGAGTCCCAAAAAGAGGAAGG + Intronic
1030322949 7:108188250-108188272 CTGGAGCACCCCAAGGAGCATGG + Intronic
1031282849 7:119826451-119826473 CAGTAGAAACATAAGAAGGAAGG + Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032914444 7:136473642-136473664 CTGGAGAAACCTAACAAGGAAGG - Intergenic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035084868 7:156249425-156249447 CTGGAGCACCACGAGAAGGAAGG + Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035743441 8:1945487-1945509 CTGGAGGCCCACCAGGAGGAAGG + Exonic
1036390319 8:8318956-8318978 CTGGAGCACCTGAAGGAGCACGG - Exonic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036726435 8:11224879-11224901 TTGGAGAACATTATGGAGGAAGG - Intergenic
1037329570 8:17730878-17730900 CTGGAGATGGATATGGAGGATGG + Intronic
1037591214 8:20313535-20313557 CAGGAGAACCTCAAAGAGGAAGG - Intergenic
1037715156 8:21391363-21391385 CAGCAAAACCATAAGGATGATGG + Intergenic
1037763949 8:21760225-21760247 CTGGAGAGCATTAAGGAGGAAGG + Intronic
1038318478 8:26507971-26507993 CTGAAGACCTATCAGGAGGAAGG - Exonic
1038397604 8:27258613-27258635 CTGGAGAACCAGAGGGGTGAGGG + Intergenic
1039220084 8:35320718-35320740 CTGGACATCCAAAGGGAGGAGGG + Intronic
1039293688 8:36126559-36126581 TTGGAGTACCAGAAGGAGGTGGG - Intergenic
1040836441 8:51736459-51736481 CTGTTGAACCATAAGGTGTATGG - Intronic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041985629 8:63919423-63919445 CTGGCAAACCATCAGGAGCAAGG - Intergenic
1042811908 8:72834950-72834972 TTGGAAAACCAGCAGGAGGAAGG + Intronic
1043331310 8:79121469-79121491 CTCAAAAACCATAAGGGGGATGG - Intergenic
1043805077 8:84661966-84661988 CTGGACAACTATAAGAAGTATGG - Intronic
1047715533 8:127591636-127591658 CTGGAGGACCTCAGGGAGGAGGG + Intergenic
1048557466 8:135494576-135494598 CTCAAGAAACAAAAGGAGGAGGG - Intronic
1052225130 9:26076747-26076769 TTGGAGTACCATAAGGAGACAGG - Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1055693122 9:78855671-78855693 CTGAAGAACCAGAAGTAGCAAGG + Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1058374463 9:104306439-104306461 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1062215787 9:135389164-135389186 CTCCAGACCCATCAGGAGGATGG + Intergenic
1186431094 X:9504836-9504858 GTGGAGTACCAGAAGGAGGTGGG + Intronic
1191842830 X:65525153-65525175 CTGAAGCAGCATAGGGAGGAGGG + Intronic
1191846303 X:65550361-65550383 GTGGAGCACCAGCAGGAGGAAGG + Intergenic
1191904750 X:66076513-66076535 CTTGAGTACCATGTGGAGGAAGG - Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1193369754 X:80680575-80680597 CTGGAAAACCTTAAGGAAGGTGG + Intronic
1193574170 X:83179058-83179080 TTGGAGAATAATAAGGGGGATGG - Intergenic
1194940482 X:100003598-100003620 AGGGAGGACCATAATGAGGATGG - Intergenic
1195954070 X:110310286-110310308 CTGGGGAACCATGAGGATGGTGG - Intronic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198444589 X:136699747-136699769 CTGGAGAACCATCTTGAGGCGGG + Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199684971 X:150257643-150257665 CTGGAGAACAAGATGGAGAAGGG - Intergenic
1200010001 X:153113745-153113767 TTTGAGAACCAGAAGGGGGAAGG - Intergenic
1200029599 X:153286177-153286199 TTTGAGAACCAGAAGGGGGAAGG + Intergenic
1202075359 Y:21031950-21031972 CTTGAGAACCACAGGGAGCAGGG - Intergenic