ID: 992076506

View in Genome Browser
Species Human (GRCh38)
Location 5:73197218-73197240
Sequence GGCTTCCAGAAGTGCCCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992076506_992076510 21 Left 992076506 5:73197218-73197240 CCTGTAGGGCACTTCTGGAAGCC No data
Right 992076510 5:73197262-73197284 TTCAGAACGTTGAGAAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992076506 Original CRISPR GGCTTCCAGAAGTGCCCTAC AGG (reversed) Intergenic
No off target data available for this crispr