ID: 992076509

View in Genome Browser
Species Human (GRCh38)
Location 5:73197239-73197261
Sequence ACTCACGCTGCTCCAGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992076509_992076511 16 Left 992076509 5:73197239-73197261 CCTCAGGCTGGAGCAGCGTGAGT No data
Right 992076511 5:73197278-73197300 AAAGTGGCTTCACTCCATAAAGG No data
992076509_992076512 17 Left 992076509 5:73197239-73197261 CCTCAGGCTGGAGCAGCGTGAGT No data
Right 992076512 5:73197279-73197301 AAGTGGCTTCACTCCATAAAGGG No data
992076509_992076510 0 Left 992076509 5:73197239-73197261 CCTCAGGCTGGAGCAGCGTGAGT No data
Right 992076510 5:73197262-73197284 TTCAGAACGTTGAGAAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992076509 Original CRISPR ACTCACGCTGCTCCAGCCTG AGG (reversed) Intergenic
No off target data available for this crispr