ID: 992076510

View in Genome Browser
Species Human (GRCh38)
Location 5:73197262-73197284
Sequence TTCAGAACGTTGAGAAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992076509_992076510 0 Left 992076509 5:73197239-73197261 CCTCAGGCTGGAGCAGCGTGAGT No data
Right 992076510 5:73197262-73197284 TTCAGAACGTTGAGAAAAAGTGG No data
992076506_992076510 21 Left 992076506 5:73197218-73197240 CCTGTAGGGCACTTCTGGAAGCC No data
Right 992076510 5:73197262-73197284 TTCAGAACGTTGAGAAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992076510 Original CRISPR TTCAGAACGTTGAGAAAAAG TGG Intergenic
No off target data available for this crispr