ID: 992082383

View in Genome Browser
Species Human (GRCh38)
Location 5:73247259-73247281
Sequence GTATTTGACCAGAAACCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992082379_992082383 9 Left 992082379 5:73247227-73247249 CCATGCTCTAAGTTCCTATGCTG No data
Right 992082383 5:73247259-73247281 GTATTTGACCAGAAACCAGACGG No data
992082381_992082383 -5 Left 992082381 5:73247241-73247263 CCTATGCTGGAATCTCCTGTATT No data
Right 992082383 5:73247259-73247281 GTATTTGACCAGAAACCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992082383 Original CRISPR GTATTTGACCAGAAACCAGA CGG Intergenic
No off target data available for this crispr