ID: 992085316

View in Genome Browser
Species Human (GRCh38)
Location 5:73273138-73273160
Sequence CTGAATCCACAGATGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992085316_992085322 25 Left 992085316 5:73273138-73273160 CCCTCCTCCATCTGTGGATTCAG No data
Right 992085322 5:73273186-73273208 CCACCCATCAATTGTGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992085316 Original CRISPR CTGAATCCACAGATGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr