ID: 992087867

View in Genome Browser
Species Human (GRCh38)
Location 5:73294300-73294322
Sequence TCCAGTATGTGAACATGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992087867_992087869 -8 Left 992087867 5:73294300-73294322 CCTCCTCATGTTCACATACTGGA No data
Right 992087869 5:73294315-73294337 ATACTGGAAAATATTTAAATAGG No data
992087867_992087870 -7 Left 992087867 5:73294300-73294322 CCTCCTCATGTTCACATACTGGA No data
Right 992087870 5:73294316-73294338 TACTGGAAAATATTTAAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992087867 Original CRISPR TCCAGTATGTGAACATGAGG AGG (reversed) Intergenic
No off target data available for this crispr