ID: 992088634

View in Genome Browser
Species Human (GRCh38)
Location 5:73299174-73299196
Sequence GTGCCGCCCGGGTTTGCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992088634_992088643 14 Left 992088634 5:73299174-73299196 CCGAGGGCAAACCCGGGCGGCAC No data
Right 992088643 5:73299211-73299233 GGCTCCGCGCGCCCAAGGAAAGG No data
992088634_992088644 15 Left 992088634 5:73299174-73299196 CCGAGGGCAAACCCGGGCGGCAC No data
Right 992088644 5:73299212-73299234 GCTCCGCGCGCCCAAGGAAAGGG No data
992088634_992088641 9 Left 992088634 5:73299174-73299196 CCGAGGGCAAACCCGGGCGGCAC No data
Right 992088641 5:73299206-73299228 CCCTGGGCTCCGCGCGCCCAAGG No data
992088634_992088637 -8 Left 992088634 5:73299174-73299196 CCGAGGGCAAACCCGGGCGGCAC No data
Right 992088637 5:73299189-73299211 GGCGGCACAGCCGTGCGCCCTGG No data
992088634_992088638 -7 Left 992088634 5:73299174-73299196 CCGAGGGCAAACCCGGGCGGCAC No data
Right 992088638 5:73299190-73299212 GCGGCACAGCCGTGCGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992088634 Original CRISPR GTGCCGCCCGGGTTTGCCCT CGG (reversed) Intergenic