ID: 992088638

View in Genome Browser
Species Human (GRCh38)
Location 5:73299190-73299212
Sequence GCGGCACAGCCGTGCGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992088626_992088638 9 Left 992088626 5:73299158-73299180 CCGGCCCGCCGGCGCTCCGAGGG No data
Right 992088638 5:73299190-73299212 GCGGCACAGCCGTGCGCCCTGGG No data
992088620_992088638 16 Left 992088620 5:73299151-73299173 CCCCCGCCCGGCCCGCCGGCGCT No data
Right 992088638 5:73299190-73299212 GCGGCACAGCCGTGCGCCCTGGG No data
992088624_992088638 10 Left 992088624 5:73299157-73299179 CCCGGCCCGCCGGCGCTCCGAGG No data
Right 992088638 5:73299190-73299212 GCGGCACAGCCGTGCGCCCTGGG No data
992088623_992088638 13 Left 992088623 5:73299154-73299176 CCGCCCGGCCCGCCGGCGCTCCG No data
Right 992088638 5:73299190-73299212 GCGGCACAGCCGTGCGCCCTGGG No data
992088621_992088638 15 Left 992088621 5:73299152-73299174 CCCCGCCCGGCCCGCCGGCGCTC No data
Right 992088638 5:73299190-73299212 GCGGCACAGCCGTGCGCCCTGGG No data
992088629_992088638 4 Left 992088629 5:73299163-73299185 CCGCCGGCGCTCCGAGGGCAAAC No data
Right 992088638 5:73299190-73299212 GCGGCACAGCCGTGCGCCCTGGG No data
992088628_992088638 5 Left 992088628 5:73299162-73299184 CCCGCCGGCGCTCCGAGGGCAAA No data
Right 992088638 5:73299190-73299212 GCGGCACAGCCGTGCGCCCTGGG No data
992088616_992088638 29 Left 992088616 5:73299138-73299160 CCACCGCTAGGCGCCCCCGCCCG No data
Right 992088638 5:73299190-73299212 GCGGCACAGCCGTGCGCCCTGGG No data
992088622_992088638 14 Left 992088622 5:73299153-73299175 CCCGCCCGGCCCGCCGGCGCTCC No data
Right 992088638 5:73299190-73299212 GCGGCACAGCCGTGCGCCCTGGG No data
992088634_992088638 -7 Left 992088634 5:73299174-73299196 CCGAGGGCAAACCCGGGCGGCAC No data
Right 992088638 5:73299190-73299212 GCGGCACAGCCGTGCGCCCTGGG No data
992088618_992088638 26 Left 992088618 5:73299141-73299163 CCGCTAGGCGCCCCCGCCCGGCC No data
Right 992088638 5:73299190-73299212 GCGGCACAGCCGTGCGCCCTGGG No data
992088630_992088638 1 Left 992088630 5:73299166-73299188 CCGGCGCTCCGAGGGCAAACCCG No data
Right 992088638 5:73299190-73299212 GCGGCACAGCCGTGCGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992088638 Original CRISPR GCGGCACAGCCGTGCGCCCT GGG Intergenic