ID: 992088643

View in Genome Browser
Species Human (GRCh38)
Location 5:73299211-73299233
Sequence GGCTCCGCGCGCCCAAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992088626_992088643 30 Left 992088626 5:73299158-73299180 CCGGCCCGCCGGCGCTCCGAGGG No data
Right 992088643 5:73299211-73299233 GGCTCCGCGCGCCCAAGGAAAGG No data
992088636_992088643 2 Left 992088636 5:73299186-73299208 CCGGGCGGCACAGCCGTGCGCCC No data
Right 992088643 5:73299211-73299233 GGCTCCGCGCGCCCAAGGAAAGG No data
992088628_992088643 26 Left 992088628 5:73299162-73299184 CCCGCCGGCGCTCCGAGGGCAAA No data
Right 992088643 5:73299211-73299233 GGCTCCGCGCGCCCAAGGAAAGG No data
992088635_992088643 3 Left 992088635 5:73299185-73299207 CCCGGGCGGCACAGCCGTGCGCC No data
Right 992088643 5:73299211-73299233 GGCTCCGCGCGCCCAAGGAAAGG No data
992088630_992088643 22 Left 992088630 5:73299166-73299188 CCGGCGCTCCGAGGGCAAACCCG No data
Right 992088643 5:73299211-73299233 GGCTCCGCGCGCCCAAGGAAAGG No data
992088634_992088643 14 Left 992088634 5:73299174-73299196 CCGAGGGCAAACCCGGGCGGCAC No data
Right 992088643 5:73299211-73299233 GGCTCCGCGCGCCCAAGGAAAGG No data
992088629_992088643 25 Left 992088629 5:73299163-73299185 CCGCCGGCGCTCCGAGGGCAAAC No data
Right 992088643 5:73299211-73299233 GGCTCCGCGCGCCCAAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992088643 Original CRISPR GGCTCCGCGCGCCCAAGGAA AGG Intergenic