ID: 992088644

View in Genome Browser
Species Human (GRCh38)
Location 5:73299212-73299234
Sequence GCTCCGCGCGCCCAAGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992088634_992088644 15 Left 992088634 5:73299174-73299196 CCGAGGGCAAACCCGGGCGGCAC No data
Right 992088644 5:73299212-73299234 GCTCCGCGCGCCCAAGGAAAGGG No data
992088636_992088644 3 Left 992088636 5:73299186-73299208 CCGGGCGGCACAGCCGTGCGCCC No data
Right 992088644 5:73299212-73299234 GCTCCGCGCGCCCAAGGAAAGGG No data
992088630_992088644 23 Left 992088630 5:73299166-73299188 CCGGCGCTCCGAGGGCAAACCCG No data
Right 992088644 5:73299212-73299234 GCTCCGCGCGCCCAAGGAAAGGG No data
992088628_992088644 27 Left 992088628 5:73299162-73299184 CCCGCCGGCGCTCCGAGGGCAAA No data
Right 992088644 5:73299212-73299234 GCTCCGCGCGCCCAAGGAAAGGG No data
992088639_992088644 -10 Left 992088639 5:73299199-73299221 CCGTGCGCCCTGGGCTCCGCGCG No data
Right 992088644 5:73299212-73299234 GCTCCGCGCGCCCAAGGAAAGGG No data
992088635_992088644 4 Left 992088635 5:73299185-73299207 CCCGGGCGGCACAGCCGTGCGCC No data
Right 992088644 5:73299212-73299234 GCTCCGCGCGCCCAAGGAAAGGG No data
992088629_992088644 26 Left 992088629 5:73299163-73299185 CCGCCGGCGCTCCGAGGGCAAAC No data
Right 992088644 5:73299212-73299234 GCTCCGCGCGCCCAAGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992088644 Original CRISPR GCTCCGCGCGCCCAAGGAAA GGG Intergenic