ID: 992088886

View in Genome Browser
Species Human (GRCh38)
Location 5:73300784-73300806
Sequence GCTCAGAGCAAAGCGATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992088886_992088891 0 Left 992088886 5:73300784-73300806 CCTGCAATCGCTTTGCTCTGAGC No data
Right 992088891 5:73300807-73300829 TGCGGCGGGAATCGGAGCCTAGG No data
992088886_992088892 1 Left 992088886 5:73300784-73300806 CCTGCAATCGCTTTGCTCTGAGC No data
Right 992088892 5:73300808-73300830 GCGGCGGGAATCGGAGCCTAGGG No data
992088886_992088898 28 Left 992088886 5:73300784-73300806 CCTGCAATCGCTTTGCTCTGAGC No data
Right 992088898 5:73300835-73300857 CTTTGCCTGGGCCAAGGGAGCGG No data
992088886_992088896 22 Left 992088886 5:73300784-73300806 CCTGCAATCGCTTTGCTCTGAGC No data
Right 992088896 5:73300829-73300851 GGCTCTCTTTGCCTGGGCCAAGG No data
992088886_992088899 29 Left 992088886 5:73300784-73300806 CCTGCAATCGCTTTGCTCTGAGC No data
Right 992088899 5:73300836-73300858 TTTGCCTGGGCCAAGGGAGCGGG No data
992088886_992088890 -8 Left 992088886 5:73300784-73300806 CCTGCAATCGCTTTGCTCTGAGC No data
Right 992088890 5:73300799-73300821 CTCTGAGCTGCGGCGGGAATCGG No data
992088886_992088897 23 Left 992088886 5:73300784-73300806 CCTGCAATCGCTTTGCTCTGAGC No data
Right 992088897 5:73300830-73300852 GCTCTCTTTGCCTGGGCCAAGGG No data
992088886_992088900 30 Left 992088886 5:73300784-73300806 CCTGCAATCGCTTTGCTCTGAGC No data
Right 992088900 5:73300837-73300859 TTGCCTGGGCCAAGGGAGCGGGG No data
992088886_992088893 15 Left 992088886 5:73300784-73300806 CCTGCAATCGCTTTGCTCTGAGC No data
Right 992088893 5:73300822-73300844 AGCCTAGGGCTCTCTTTGCCTGG No data
992088886_992088894 16 Left 992088886 5:73300784-73300806 CCTGCAATCGCTTTGCTCTGAGC No data
Right 992088894 5:73300823-73300845 GCCTAGGGCTCTCTTTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992088886 Original CRISPR GCTCAGAGCAAAGCGATTGC AGG (reversed) Intergenic
No off target data available for this crispr