ID: 992093356

View in Genome Browser
Species Human (GRCh38)
Location 5:73339008-73339030
Sequence GCCCGTATCCTGCTGGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992093356_992093363 19 Left 992093356 5:73339008-73339030 CCCTGAACCAGCAGGATACGGGC No data
Right 992093363 5:73339050-73339072 AGTGTCTGTCAGCTGTGTGGTGG No data
992093356_992093362 16 Left 992093356 5:73339008-73339030 CCCTGAACCAGCAGGATACGGGC No data
Right 992093362 5:73339047-73339069 TCAAGTGTCTGTCAGCTGTGTGG No data
992093356_992093364 22 Left 992093356 5:73339008-73339030 CCCTGAACCAGCAGGATACGGGC No data
Right 992093364 5:73339053-73339075 GTCTGTCAGCTGTGTGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992093356 Original CRISPR GCCCGTATCCTGCTGGTTCA GGG (reversed) Intergenic
No off target data available for this crispr