ID: 992093748

View in Genome Browser
Species Human (GRCh38)
Location 5:73341485-73341507
Sequence ATGTGAGGATGCAAAGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992093748_992093750 -2 Left 992093748 5:73341485-73341507 CCAACTTCTTTGCATCCTCACAT No data
Right 992093750 5:73341506-73341528 ATGACCTTCTCTCTGTACTTAGG No data
992093748_992093752 7 Left 992093748 5:73341485-73341507 CCAACTTCTTTGCATCCTCACAT No data
Right 992093752 5:73341515-73341537 TCTCTGTACTTAGGCACTCCTGG No data
992093748_992093754 30 Left 992093748 5:73341485-73341507 CCAACTTCTTTGCATCCTCACAT No data
Right 992093754 5:73341538-73341560 CATCCCTTCCTCTCCTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992093748 Original CRISPR ATGTGAGGATGCAAAGAAGT TGG (reversed) Intergenic
No off target data available for this crispr